Direkt zum Inhalt
Merck

EHU026401

Sigma-Aldrich

MISSION® esiRNA

targeting human STIM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGGCAGTCCGTAACATCCACAAACTGATGGACGATGATGCCAATGGTGATGTGGATGTGGAAGAAAGTGATGAGTTCCTGAGGGAAGACCTCAATTACCATGACCCAACAGTGAAACACAGCACCTTCCATGGTGAGGATAAGCTCATCAGCGTGGAGGACCTGTGGAAGGCATGGAAGTCATCAGAAGTATACAATTGGACCGTGGATGAGGTGGTACAGTGGCTGATCACATATGTGGAGCTGCCTCAGTATGAGGAGACCTTCCGGAAGCTGCAGCTCAGTGGCCATGCCATGCCAAGGCTGGCTGTCACCAACACCACCATGACAGGGACTGTGCTGAAGATGACAGACCGGAGTCATCGGCAGAAGCTGCAGCTGAAGGCTCTGGATACAGTGCTCTTTGGGCCTCCTCTCTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Dongyu Wei et al.
Frontiers in cellular neuroscience, 11, 400-400 (2018-01-10)
Store-operated calcium channels (SOCs) are highly calcium-selective channels that mediate calcium entry in various cell types. We have previously reported that intraplantar injection of YM-58483 (a SOC inhibitor) attenuates chronic pain. A previous study has reported that the function of
Yan-Yang Mao et al.
Biochemical and biophysical research communications, 505(1), 119-125 (2018-09-23)
The prevention and treatment of coronary heart disease (CHD) is a difficult problem to be solved. More and more studies have found that circular RNAs (circRNAs) may play important roles in the development of CHD. Here detection of vascular smooth
Yadong Wang et al.
Oncotarget, 7(52), 86584-86593 (2016-11-20)
This study aimed to address the potential role of STIM1 (stromal interaction molecule 1) in lung tumorigenesis. Colony formation in soft agar assay and tumorigenicity in nude mice assay were conducted. Western blot, immunohistochemistry and quantitative real-time polymerase chain reaction
Ping Li et al.
Cell calcium, 71, 45-52 (2018-04-02)
Bone resorption is mainly mediated by osteoclasts (OCs), whose formation and function are regulated by intracellular Ca2+ oscillation. Our previous studies demonstrated that fluid shear stress (FSS) lead to Ca2+ oscillation through mechanosensitive cation-selective channels. However, the specific channels responsible
Ping Li et al.
PloS one, 12(5), e0177484-e0177484 (2017-05-12)
Calcium signal plays an important role in a variety of cancer cell metabolism, but knowledge on its role in head and neck squamous cell carcinoma (HNSCC) is limited. Store-operated calcium entry (SOCE) is the principal Ca2+ entry mechanism that maintains

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.