Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

View All Documentation

EHU021751

Sigma-Aldrich

MISSION® esiRNA

targeting human ALKBH5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTCAAGCCTATTCGGGTGTCGGAACCAGTGCTTTCCCTGCCGGTGCGCAGGGGAAGCGTGACTGTGCTCAGTGGATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGGACATCAAGGAGCGCCGAGCAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGGTTGGAAACAAAGTCCCTGAGCAGCTCCGTGTTACCACCCAGCTATGCTTCAGATCGCCTGTCAGGAAACAACAGGGACCCTGCTCTGAAACCCAAGCGGTCCCACCGCAAGGCAGACCCTGATGCTGCCCACAGGCCACGGATCCTGGAGATGGACAAGGAAGAGAACCGGCGCTCGGTGCTGCTGCCCACACACCGGCGGAGGGGTAGCTTCAGCTCTGAGAACTACTGGCGCAAGTCATACGAGTCCTCAGAGGACTGCTCTGAGGCAGCAGGCAGCCCTGCCCGAAAGTCTACCCGCCGCCCTCCTGGGAACTCTGGCTC

Ensembl | Human Hinterlegungsnummer

ENSG00000091542

NCBI-Hinterlegungsnummer

NM_017758

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ALKBH5(54890) , ALKBH5(54890)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhiyuan Zhu et al.
Gene, 731, 144348-144348 (2020-01-14)
Mounting evidence demonstrates that N6-methyladenosine (m6A) play critical roles of m6A in the epigenetic regulation, especially for human cancer. The m6A modification is installed by methyltransferase and erased demethylases, leading to the significant modification for gene expression and cell fate.
Lianpin Wu et al.
BMC cancer, 19(1), 326-326 (2019-04-07)
Breast cancer (BC) displays striking genetic, epigenetic and phenotypic diversity. N6-methyladenosine (m6A) in mRNA has emerged as a crucial epitranscriptomic modification that controls cancer self-renewal and cell fate. However, the key enzymes of m6A expression and function in human breast
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Omprakash Shriwas et al.
Apoptosis : an international journal on programmed cell death, 25(3-4), 233-246 (2020-01-25)
Platinum based drugs alone or in combination with 5FU and docetaxel are common regimen chemotherapeutics for the treatment of advanced OSCC. Chemoresistance is one of the major factors of treatment failure in OSCC. Human RNA helicase DDX3 plays an important
Rong Wu et al.
Cell research, 29(1), 23-41 (2018-12-06)
While N6-methyladenosine (m6A), the most abundant internal modification in eukaryotic mRNA, is linked to cell differentiation and tissue development, the biological significance of m6A modification in mammalian glial development remains unknown. Here, we identify a novel m6A reader, Prrc2a (Proline
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.