Direkt zum Inhalt
Merck

EHU019961

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGCGGAAAGCTGTGAAGATACGGGAGAGAACTCCAGAAGACATTTTTAAACCTACTAATGGGATCATTCATCATTTTAAAACCATGCACCGATACACACTGGAAATGTTCAGAACTTGCCAGTTTTGTCCTCAGTTTCGGGAGATCATCCACAAAGCCCTCATCGACAGAAACATCCAGGCCACCCTGGAAAGCCAGAAGAAACTCAACTGGTGTCGAGAAGTCCGGAAGCTTGTGGCGCTGAAAACGAACGGTGACGGCAATTGCCTCATGCATGCCACTTCTCAGTACATGTGGGGCGTTCAGGACACAGACTTGGTACTGAGGAAGGCGCTGTTCAGCACGCTCAAGGAAACAGACACACGCAACTTTAAATTCCGCTGGCAACTGGAGTCTCTCAAATCTCAGGAATTTGTTGAAACGGGGCTTTGCTATGATACTCGGAACTGGAATGATGAATGGGACAATCTTATCAAAATGGCTTCCACAGACACACCCATG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhipeng Li et al.
Brain, behavior, and immunity, 79, 228-235 (2019-02-11)
Neuroinflammation is now recognized to be a feature of many neurological disorders. More accumulated evidences suggested chrysin which was contained in honey, propolis, vegetables, fruits and plants can exert biological activities including anti-neuroinflammatory effects. However, the precise molecular mechanisms of
Hongjun Zhao et al.
Rheumatology (Oxford, England), 56(5), 835-843 (2017-02-06)
TNF-α-induced protein 3 ( TNFAIP3 ) is one of the major SLE susceptibility genes involved in the regulation of inflammatory responses through modulation of the nuclear factor-κB (NF-κB) pathway. We aim to assess TNFAIP3 expression in CD4 + T cells
Wenjing Feng et al.
Biochemical and biophysical research communications, 482(4), 1107-1113 (2016-12-05)
The innate immune response provides the first line of defense against viruses and other pathogens by responding to specific microbial molecules. A20 is a cytoplasmic ubiquitin-editing protein that negatively regulates the retinoic acid-inducible gene I (RIG-I)-mediated activation of interferon regulatory
Meng Qin et al.
Frontiers in pharmacology, 8, 953-953 (2018-01-10)
Atherosclerosis (AS) is a chronic inflammatory disease and endothelial cell injury is the initial event. In this study, we investigated the protective effects of ginsenoside F1 (GF1) on AS and the potential molecular mechanisms of ox-LDL induced endothelial injury. ApoE-/-
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.