Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU081381

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lrp5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACTCACGGGTGTCAAAGAGGCCTCTGCACTGGACTTTGATGTGTCCAACAATCACATCTACTGGACTGATGTTAGCCTCAAGACGATCAGCCGAGCCTTCATGAATGGGAGCTCAGTGGAGCACGTGATTGAGTTTGGCCTCGACTACCCTGAAGGAATGGCTGTGGACTGGATGGGCAAGAACCTCTATTGGGCGGACACAGGGACCAACAGGATTGAGGTGGCCCGGCTGGATGGGCAGTTCCGGCAGGTGCTTGTGTGGAGAGACCTTGACAACCCCAGGTCTCTGGCTCTGGATCCTACTAAAGGCTACATCTACTGGACTGAGTGGGGTGGCAAGCCAAGGATTGTGCGGGCCTTCATGGATGGGACCAATTGTATGACACTGGTAGACAAGGTGGGCCGGGCCAACGACCTCACCATTGATTATGCCGACCAGCGACTGTACTGGACTGACCTGGACACCAACATG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nellie Y Loh et al.
Cell metabolism, 21(2), 262-273 (2015-02-05)
Common variants in WNT pathway genes have been associated with bone mass and fat distribution, the latter predicting diabetes and cardiovascular disease risk. Rare mutations in the WNT co-receptors LRP5 and LRP6 are similarly associated with bone and cardiometabolic disorders.
Ioanna Papathanasiou et al.
Arthritis research & therapy, 14(2), R82-R82 (2012-04-20)
Events normally taking place in the terminal chondrocyte differentiation in the growth plate are also observed during osteoarthritis (OA) development, suggesting that molecules, such as Wnts and bone morphogenetic proteins (BMPs) regulating chondrocyte activity in the growth plate, may play
Jessica Svedlund et al.
Endocrine-related cancer, 21(2), 231-239 (2013-12-03)
Primary hyperparathyroidism (pHPT) resulting from parathyroid tumors is a common endocrine disorder with incompletely understood etiology. In renal failure, secondary hyperparathyroidism (sHPT) occurs with multiple tumor development as a result of calcium and vitamin D regulatory disturbance. The aim of
Luqi Zhang et al.
Neurochemistry international, 87, 13-21 (2015-05-12)
Emerging studies have suggested the involvement of dysregulated Wnt/β-catenin cascade in the etiology of Alzheimer's disease (AD). Recently, genetic variations in Wnt co-receptor low density lipoprotein receptor-related protein (LRP) 6 causing reduced Wnt signaling has been linked to late-onset AD.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique