Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU017691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Kif11

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCAAACCAAGACACAGGAACTTGAAACCACTCAGAAACATTTGCAAGAAACAAAATTACAACTGGTTAAAGAGGAATATGTCTCTTCAGCCTTGGAAAGAACCGAGAAGACACTGCATGACACGGCCAGCAAGTTGCTTAACACGGTTAAAGAAACCACCAGGGCTGTATCTGGTCTACATTCTAAACTGGACCGCAAGAGAGCAATCGATGAGCACAACGCTGAAGCTCAGGAGAGCTTTGGCAAAAACCTCAACAGTCTGTTTAATAATATGGAAGAATTGATTAAGGATGGCAGTGCGAAACAAAAGGCCATGCTAGACGTTCATAAGACACTGTTTGGTAACCTGATGTCTTCTAGTGTCTCTGCATTAGACACCATTACCACGACAGCACTTGAATCTCTCGTGTCTATTCCAGAAAATGTGTCCGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Myles Fennell et al.
Assay and drug development technologies, 13(7), 347-355 (2015-08-13)
Uptake of nutrients, such as glucose and amino acids, is critical to support cell growth and is typically mediated by cell surface transporters. An alternative mechanism for the bulk uptake of nutrients from the extracellular space is macropinocytosis, a nonclathrin
Daniel Edinger et al.
Drug delivery and translational research, 4(1), 84-95 (2015-03-20)
Two antitumoral siRNAs (directed against target genes Eg5 and Ran) complexed with one of three sequence-defined cationic oligomers were compared in gene silencing in vitro and antitumoral in vivo efficacy upon intratumoral injection. Two lipo-oligomers (T-shape 49, i-shape 229) and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique