EHUEGFP
MISSION® esiRNA
targeting EGFP
Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
About This Item
Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Produits recommandés
Description
Powered by Eupheria Biotech
Niveau de qualité
Gamme de produits
MISSION®
Forme
lyophilized powder
Conditions d'expédition
ambient
Température de stockage
−20°C
Catégories apparentées
Description générale
EHUEGFP targets enhanced Green Fluorescent Protein (i.e. eGFP). It can be used as a negative control in systems lacking eGFP, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Autres remarques
esiRNA cDNA target sequence: GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTA
Informations légales
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Code de la classe de stockage
10 - Combustible liquids
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Faites votre choix parmi les versions les plus récentes :
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Les clients ont également consulté
Shalaka Chitale et al.
Nucleic acids research, 45(10), 5901-5912 (2017-04-13)
Repair of damaged DNA relies on the recruitment of DNA repair factors in a well orchestrated manner. As a prerequisite, the chromatin needs to be decondensed by chromatin remodelers to allow for binding of repair factors and for DNA repair
Lin Zhou et al.
Zygote (Cambridge, England), 24(1), 89-97 (2015-02-13)
ING2 (inhibitor of growth protein-2) is a member of the ING-gene family and participates in diverse cellular processes involving tumor suppression, DNA repair, cell cycle regulation, and cellular senescence. As a subunit of the Sin3 histone deacetylase complex co-repressor complex
Aman Kumar et al.
Molecular biology reports, 47(9), 7273-7276 (2020-08-06)
NLRP3 pathway plays a vital role in the pathogenesis of different human cancers but still the regulation of NLRP3 pathway largely unknown. Therefore, we examined the levels of NLRP3 and its downstream components (caspase-1 and IL-1β) and its relationship with
Milica Momcilovic et al.
Cancer cell, 33(5), 905-921 (2018-05-16)
Altered metabolism is a hallmark of cancer growth, forming the conceptual basis for development of metabolic therapies as cancer treatments. We performed in vivo metabolic profiling and molecular analysis of lung squamous cell carcinoma (SCC) to identify metabolic nodes for therapeutic
Aman Kumar et al.
Scientific reports, 9(1), 8189-8189 (2019-06-05)
Renal cell carcinoma (RCC) is the leading cause among cancer-related deaths due to urological cancers, which results in response to combination of genetic and epigenetic factors. Histone methylations have been implicated in renal tumorigenesis but their clinical significance and underlying
Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..
Contacter notre Service technique