Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU155151

Sigma-Aldrich

MISSION® esiRNA

targeting human EP300

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGCTTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGAGGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAATTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATTATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCAGGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGACTACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAATTGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG

Numéro d'accès Ensembl | humain

ENSG00000100393

Numéro d'accès NCBI

NM_001429

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... EP300(2033) , EP300(2033)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jia Tao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 1727-1733 (2018-08-19)
Pulmonary fibrosis is strongly correlated with inflammation factors, cytokine, and collagen secretion, whereby discoidin domain receptor 1 (DDR1) signaling plays an important role. EP300 is defined as an acetyltransferase that can acetylate histone and has been broadly studied in several
Mizuo Ando et al.
Nature communications, 10(1), 2188-2188 (2019-05-18)
Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation outside the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks
Alexander Ring et al.
BMC cancer, 20(1), 1076-1076 (2020-11-11)
Triple negative breast cancer (TNBC) is an aggressive breast cancer subtype with basal features, lacking the expression of receptors targeted successfully in other breast cancer subtypes. Treatment response to adjuvant and neoadjuvant chemotherapy is often short-lived and metastatic spread occurs
Karen Dendoncker et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(26), 12942-12951 (2019-06-12)
Glucocorticoid resistance (GCR) is defined as an unresponsiveness to the therapeutic effects, including the antiinflammatory ones of glucocorticoids (GCs) and their receptor, the glucocorticoid receptor (GR). It is a problem in the management of inflammatory diseases and can be congenital
Alejandro Ropolo et al.
Frontiers in endocrinology, 11, 411-411 (2020-07-14)
Autophagy is an evolutionarily preserved degradation process of cytoplasmic cellular constituents, which participates in cell response to disease. We previously characterized VMP1 (Vacuole Membrane Protein 1) as an essential autophagy related protein that mediates autophagy in pancreatic diseases. We also
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique