Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU078901

Sigma-Aldrich

MISSION® esiRNA

targeting human GPI

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCAAGGCACCAAGATGATACCCTGTGACTTCCTCATCCCGGTCCAGACCCAGCACCCCATACGGAAGGGTCTGCATCACAAGATCCTCCTGGCCAACTTCTTGGCCCAGACAGAGGCCCTGATGAGGGGAAAATCGACGGAGGAGGCCCGAAAGGAGCTCCAGGCTGCGGGCAAGAGTCCAGAGGACCTTGAGAGGCTGCTGCCACATAAGGTCTTTGAAGGAAATCGCCCAACCAACTCTATTGTGTTCACCAAGCTCACACCATTCATGCTTGGAGCCTTGGTCGCCATGTATGAGCACAAGATCTTCGTTCAGGGCATCATCTGGGACATCAACAGCTTTGACCAGTGGGGAGTGGAGCTGGGAAAGCAGCTGGCTAAGAAAATAGAGCCTGAGCTTGATGGCAGTGCTCAAGTGACCTCTCACGACGCTTCTACC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yiran Li et al.
International journal of oncology, 47(3), 1017-1024 (2015-07-24)
Autocrine motility factor (AMF) as a cytokine and a growth factor, is known to regulate tumor cell growth and motility in the progress of various human malignant tumors, however, its role in endometrial cancer (EC) has not been fully studied.
Ming Zong et al.
Arthritis research & therapy, 17, 100-100 (2015-04-19)
Fibroblast-like synoviocytes (FLS) play an important role in the pathogenesis of rheumatoid arthritis (RA). This study aimed to investigate the role of glucose 6-phosphate isomerase (GPI) in the proliferation of RA-FLS. The distribution of GPI in synovial tissues from RA
Dongling Zou et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 6725-6732 (2015-04-03)
Chemotherapy is the preferred therapeutic approach for the therapy of advanced ovarian cancer, but 5-year survival rate remains low due to the development of drug resistance. Increasing evidence has documented that microRNAs (miRNAs) act important roles in drug resistance in
Gina Shaw-Hallgren et al.
PloS one, 9(5), e96506-e96506 (2014-05-13)
Nemo-like kinase (NLK), a proline-directed serine/threonine kinase regulated by phosphorylation, can be localized in the cytosol or in the nucleus. Whether the localization of NLK can affect cell survival or cell apoptosis is yet to be disclosed. In the present

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique