Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU076761

Sigma-Aldrich

MISSION® esiRNA

targeting human EGFR

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Meifang Li et al.
Journal of experimental & clinical cancer research : CR, 38(1), 211-211 (2019-05-24)
Epidermal growth factor receptor (EGFR) and epidermal growth factor receptor pathway substrate 8 (Eps8) have been widely reported to be expressed in various tumors. Eps8 is an important active kinase substrate of EGFR that directly binds to the juxtamembrane (JXM)
Yi-Yang Peng et al.
Biomacromolecules, 19(10), 4052-4058 (2018-08-31)
Strong signaling cascades derived from upregulation and overexpression of growth factors such as the EGF-family (epidermal growth factors) have been crucially related to cancer pathogenesis. Gene silencing techniques to modulate the expression of oncogenes and tumor suppresor genes are a
Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Jia Shen et al.
Journal of experimental & clinical cancer research : CR, 37(1), 157-157 (2018-07-19)
Lycorine has been revealed to inhibit the development of many kinds of malignant tumors, including glioblastoma multiforme (GBM). Although compelling evidences demonstrated Lycorine's inhibition on cancers through some peripheral mechanism, in-depth mechanism studies of Lycotine's anti-GBM effects still call for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique