Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU051271

Sigma-Aldrich

MISSION® esiRNA

targeting human PDGFRB

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGTGACACTGCACGAGAAGAAAGGGGACGTTGCACTGCCTGTCCCCTATGATCACCAACGTGGCTTTTCTGGTATCTTTGAGGACAGAAGCTACATCTGCAAAACCACCATTGGGGACAGGGAGGTGGATTCTGATGCCTACTATGTCTACAGACTCCAGGTGTCATCCATCAACGTCTCTGTGAACGCAGTGCAGACTGTGGTCCGCCAGGGTGAGAACATCACCCTCATGTGCATTGTGATCGGGAATGAGGTGGTCAACTTCGAGTGGACATACCCCCGCAAAGAAAGTGGGCGGCTGGTGGAGCCGGTGACTGACTTCCTCTTGGATATGCCTTACCACATCCGCTCCATCCTGCACATCCCCAGTGCCGAGTTAGAAGACTCGGGGACCTACACCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bhanupriya Madarampalli et al.
Biochimica et biophysica acta. Molecular basis of disease, 1865(6), 1516-1524 (2019-03-17)
Cadherins are homophilic cell-to-cell adhesion molecules that help cells respond to environmental changes. Newly formed cadherin junctions are associated with increased cell phosphorylation, but the pathways driving this signaling response are largely unknown. Since cadherins have no intrinsic signaling activity
Zachary K Goldsmith et al.
Investigative ophthalmology & visual science, 59(11), 4486-4495 (2018-09-08)
Vitreous seeding remains the primary reason for treatment failure in eyes with retinoblastoma (Rb). Systemic and intra-arterial chemotherapy, each with its own inherent set of complications, have improved salvage rates for eyes with advanced disease, but the location and biology
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Yaoping Liu et al.
Genome research, 25(5), 679-689 (2015-04-11)
Candida albicans, the major invasive fungal pathogen of humans, can cause both debilitating mucosal infections and fatal invasive infections. Understanding the complex nature of the host-pathogen interaction in each of these contexts is essential to developing desperately needed therapies to
Alessia Alunno et al.
Journal of cellular and molecular medicine, 19(7), 1689-1696 (2015-03-11)
It has been recently reported that telocytes, a stromal (interstitial) cell subset involved in the control of local tissue homeostasis, are hampered in the target organs of inflammatory/autoimmune disorders. Since no data concerning telocytes in minor salivary glands (MSGs) are

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique