Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU030401

Sigma-Aldrich

MISSION® esiRNA

targeting human MELK

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAAACCCAAGGGTAACAAGGATTACCATCTACAGACATGCTGTGGGAGTCTGGCTTATGCAGCACCTGAGTTAATACAAGGCAAATCATATCTTGGATCAGAGGCAGATGTTTGGAGCATGGGCATACTGTTATATGTTCTTATGTGTGGATTTCTACCATTTGATGATGATAATGTAATGGCTTTATACAAGAAGATTATGAGAGGAAAATATGATGTTCCCAAGTGGCTCTCTCCCAGTAGCATTCTGCTTCTTCAACAAATGCTGCAGGTGGACCCAAAGAAACGGATTTCTATGAAAAATCTATTGAACCATCCCTGGATCATGCAAGATTACAACTATCCTGTTGAGTGGCAAAGCAAGAATCCTTTTATTCACCTCGATGATGATTGCGTAACAGAACTTTCTGTACATCACAGAAACAACAGGCAAACAATGGAGGATTTAATTTCACTGTGGCAGTATGATCACCTCACGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ke Wang et al.
Oncology reports, 39(6), 2777-2786 (2018-04-06)
Retinoblastoma (Rb) is the most frequent primary intraocular tumor usually diagnosed in infants and children, and current therapy for such disease is still limited. Corosolic acid (CA), an ursane-type pentacyclic triterpene, has been assessed as a promising anticancer agent with little impact
Gang Li et al.
Oncology letters, 15(6), 9934-9940 (2018-05-29)
Maternal embryonic leucine zipper kinase (MELK) is an important regulator in tumorigenesis of human breast cancer, and if silenced leads to programmed cell death in specific breast cancer cell lines, including MDA-MB-231 cells. In the present study, RNA interference, proliferation
Antonio Cigliano et al.
Medicina (Kaunas, Lithuania), 56(1) (2019-12-22)
Background and Objectives: Intrahepatic cholangiocarcinoma (iCCA) is a pernicious tumor characterized by a dismal outcome and scarce therapeutic options. To substantially improve the prognosis of iCCA patients, a better understanding of the molecular mechanisms responsible for development and progression of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique