Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU028461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdkn1b

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGCCAACAGAACAGAAGAAAATGTTTCAGACGGTTCCCCGAACGCTGGCACTGTGGAGCAGACGCCCAAGAAGCCCGGCCTTCGACGCCAGACGTAAACAGCTCCGGTGGGTTAATGAGGAAGAACACAAAACTGACACCCCATCTGGGCTGCGCTCCCCGGGGGGCCTGCAGACCCCAGGACTGCTGGCAGATTAGTTGCCTGCCAGGAGGAATTACTTTCCTTGATCAAAAAAATTAACACTGGGGAAGGCTGGAATCACTTGAGGGGACTATAATGCAGTATTTGCACCCCAAGATATTTACCTTAAAGTGGAATCAGAATGAGGTTCCCAAGCAAGAACTTGCCACCAAGGCCCCAAAGGATAGGGACGGTCGTATCCTTATGAATCCCACTAAAACTTAGGCTGGGAATGACAGTTTTCCTTTCCAGTCTCAGTTCATGAGAACCCATTTCCCAGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Abedul Haque et al.
Apoptosis : an international journal on programmed cell death, 20(7), 986-995 (2015-04-11)
Combinatorial approaches using two or more compounds are gaining increasing attention for cancer therapy. We have previously reported that the combination of the EGFR-TKI erlotinib and epigallocatechin-3-gallate (EGCG) exhibited synergistic chemopreventive effects in head and neck cancers by inducing the
Juan Qin et al.
Oncotarget, 6(9), 6944-6958 (2015-03-10)
Side population (SP) contains cancer stem-like cells (CSLCs). In this study, we characterized SP cells from nasopharyngeal carcinoma (NPC) cell lines and found that SP cells had a higher self-renewal ability in vitro and greater tumorigenicity in vivo. The AKT

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service