Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU131091

Sigma-Aldrich

MISSION® esiRNA

targeting human KL

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGAATGACCGACCACAGCATCAAAGAATGTCAAAAATCTCTGGACTTTGTACTAGGTTGGTTTGCCAAACCCGTATTTATTGATGGTGACTATCCCGAGAGCATGAAGAATAACCTTTCATCTATTCTGCCTGATTTTACTGAATCTGAGAAAAAGTTCATCAAAGGAACTGCTGACTTTTTTGCTCTTTGCTTTGGACCCACCTTGAGTTTTCAACTTTTGGACCCTCACATGAAGTTCCGCCAATTGGAATCTCCCAACCTGAGGCAACTGCTTTCCTGGATTGACCTTGAATTTAACCATCCTCAAATATTTATTGTGGAAAATGGCTGGTTTGTCTCAGGGACCACCAAGAGAGATGATGCCAAATATATGTATTACCTCAAAAAGTTCATCATGGAAACCTTAAAAGCCATCAAGCTGGATGGGGTGGATGTCATCGGGTATACCGCATGGTCCCTCATGGATGGTTTCGAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KL(9365) , KL(9365)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lin Chen et al.
PloS one, 8(3), e58413-e58413 (2013-03-22)
Klotho was originally characterized as an aging suppressor gene that predisposed Klotho-deficient mice to premature aging-like syndrome. Although Klotho was recently reported to exhibit tumor suppressive properties during various malignant transformations, the functional role and molecular mechanism of Klotho in
Xiaowei Tang et al.
Laboratory investigation; a journal of technical methods and pathology, 96(2), 197-205 (2015-08-04)
Klotho, an anti-aging gene, has recently been shown to contribute to human hepatic tumorigenesis. In addition, it is known that Wnt signaling is antagonized by the protein klotho. Because augmented Wnt signaling has an important role in tumorigenesis of human
Youliang Yan et al.
Molecular medicine reports, 15(4), 1777-1785 (2017-03-06)
Klotho is a recently discovered anti‑aging gene, which has been reported as a tumor suppressor in numerous human malignancies; however, the role of Klotho in human ovarian cancer remains to be elucidated. The aim of the present study was to
Jinpeng Hu et al.
Experimental and therapeutic medicine, 21(5), 486-486 (2021-04-02)
Early reperfusion is the most effective and important treatment for acute myocardial infarction. However, reperfusion therapy often leads to a certain degree of myocardial damage. The aim of the present study was to identify the role of klotho, and the
Lina Xing et al.
Life sciences, 269, 119068-119068 (2021-01-22)
Podocyte apoptosis plays an important role in the pathogenesis of diabetic nephropathy (DN). Astragaloside IV (AS-IV) has been shown to protect against podocyte apoptosis. Here we aim to investigate the mechanism responsible for the protective effects of AS-IV. Diabetic db/db

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service