Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU123781

Sigma-Aldrich

MISSION® esiRNA

targeting human CYB5R3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTACCTCTCGGCTCGAATTGATGGAAACCTGGTCGTCCGGCCCTATACACCCATCTCCAGCGATGATGACAAGGGCTTCGTGGACCTGGTCATCAAGGTTTACTTCAAGGACACCCATCCCAAGTTTCCCGCTGGAGGGAAGATGTCTCAGTACCTGGAGAGCATGCAGATTGGAGACACCATTGAGTTCCGGGGCCCCAGTGGGCTGCTGGTCTACCAGGGCAAAGGGAAGTTCGCCATCCGACCTGACAAAAAGTCCAACCCTATCATCAGGACAGTGAAGTCTGTGGGCATGATCGCGGGAGGGACAGGCATCACCCCGATGCTGCAGGTGATCCGCGCCATCATGAAGGACCCTGATGACCACACTGTGTGCCACCTGCTCTTTGCCAACCAGACCGAGAAGGACATCCTGCTGCGACCTGAGCTGGAGGAACTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Birte Plitzko et al.
Drug metabolism and disposition: the biological fate of chemicals, 44(10), 1617-1621 (2016-07-30)
The importance of the mitochondrial amidoxime reducing component (mARC)-containing enzyme system in N-reductive metabolism has been studied extensively. It catalyzes the reduction of various N-hydroxylated compounds and therefore acts as the counterpart of cytochrome P450- and flavin-containing monooxygenase-catalyzed oxidations at
Manoj Reddy Medapati et al.
Thyroid : official journal of the American Thyroid Association, 25(5), 514-527 (2015-03-07)
Expression of the small calcium-binding protein S100A4 is associated with poor prognosis in patients with thyroid cancer (TC). The authors have previously shown that S100A4 is a target for relaxin and insulin-like peptide 3 signaling in TC cells and that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service