Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU061701

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFSF11

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTCAAGGAGCTGTGCAAAAGGAATTACAACATATCGTTGGATCACAGCACATCAGAGCAGAGAAAGCGATGGTGGATGGCTCATGGTTAGATCTGGCCAAGAGGAGCAAGCTTGAAGCTCAGCCTTTTGCTCATCTCACTATTAATGCCACCGACATCCCATCTGGTTCCCATAAAGTGAGTCTGTCCTCTTGGTACCATGATCGGGGTTGGGCCAAGATCTCCAACATGACTTTTAGCAATGGAAAACTAATAGTTAATCAGGATGGCTTTTATTACCTGTATGCCAACATTTGCTTTCGACATCATGAAACTTCAGGAGACCTAGCTACAGAGTATCTTCAACTAATGGTGTACGTCACTAAAACCAGCATCAAAATCCCAAGTTCTCATACCCTGATGAAAGGAGGAAGCACCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Aase Haj Hensvold et al.
Arthritis research & therapy, 17, 239-239 (2015-09-05)
Receptor activator of nuclear factor kappa B ligand (RANKL) is a key regulator of bone metabolism. Anti-citrullinated protein antibodies (ACPA) have been suggested to cause bone destruction by osteoclast activation. We investigated the relationship between RANKL and ACPA in patients
Hae-Rim Kim et al.
PloS one, 10(4), e0124909-e0124909 (2015-04-22)
Vascular endothelial growth factor (VEGF) has angiogenic, inflammatory, and bone-destructive roles in rheumatoid arthritis (RA). We aimed to determine the unique role of VEGF in osteoclastogenesis in RA. VEGF-induced receptor activator of nuclear factor ҡB ligand (RANKL) expression was determined
Hong Hu et al.
Breast cancer research and treatment, 146(3), 515-523 (2014-07-11)
The receptor activator of nuclear factor-κB ligand (RANKL) acts as a paracrine factor in progesterone-induced mammary epithelial proliferation and tumorigenesis. This evidence comes mainly from mouse models. Our aim was to examine whether RANKL expression in human normal and malignant

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service