Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU046551

Sigma-Aldrich

MISSION® esiRNA

targeting human PRNP

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACCAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGAGGAAGGTCTTCCTGTTTTCACCATCTTTCTAATCTTTTTCCAGCTTGAGGGAGGCGGTATCCACCTGCAGCCCTTTTAGTGGTGGTGTCTCACTCTTTCTTCTCTCTTTGTCCCGGATAGGCTAATCAATACCCTTGGCACTGATGGGCACTGGAAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Heather Bender et al.
PloS one, 14(7), e0219995-e0219995 (2019-07-23)
Prion diseases are members of neurodegenerative protein misfolding diseases (NPMDs) that include Alzheimer's, Parkinson's and Huntington diseases, amyotrophic lateral sclerosis, tauopathies, traumatic brain injuries, and chronic traumatic encephalopathies. No known therapeutics extend survival or improve quality of life of humans
Yong-Seok Han et al.
Cell death & disease, 7(10), e2395-e2395 (2016-10-07)
Mesenchymal stem cells (MSCs) are 'adult' multipotent cells that promote regeneration of injured tissues in vivo. However, differences in oxygenation levels between normoxic culture conditions (21% oxygen) and both the MSC niche (2-8% oxygen) and ischemic injury-induced oxidative stress conditions
Stefano Martellucci et al.
International journal of molecular sciences, 20(2) (2019-01-19)
Human Dental Pulp Stem Cells (hDPSCs) represent a type of adult mesenchymal stem cells that have the ability to differentiate in vitro in several lineages such as odontoblasts, osteoblasts, chondrocytes, adipocytes and neurons. In the current work, we used hDPSCs
Stefano Martellucci et al.
Prion, 12(2), 117-126 (2018-04-13)
Cellular prion protein (PrPC) is expressed in a wide variety of stem cells in which regulates their self-renewal as well as differentiation potential. In this study we investigated the presence of PrPC in human dental pulp-derived stem cells (hDPSCs) and
Jin-Young Park et al.
Oncotarget, 6(7), 5342-5353 (2015-03-07)
Hypoxia decreases cytotoxic responses to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) protein. Cellular prion protein (PrPc) is regulated by HIF-1α in neurons. We hypothesized that PrPc is involved in hypoxia-mediated resistance to TRAIL-induced apoptosis. We found that hypoxia induced PrPc

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service