Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU019541

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTAGCACGGCTCTGGAAACACGCAAACCCTGGTGGTCCCATTTATTTCCTAAAGGGTCTGTCTCACCTCCACATCCTTAACTTGGAGTCCAACGGCTTTGACGAGATCCCAGTTGAGGTCTTCAAGGATTTATTTGAACTAAAGATCATCGATTTAGGATTGAATAATTTAAACACACTTCCAGCATCTGTCTTTAATAATCAGGTGTCTCTAAAGTCATTGAACCTTCAGAAGAATCTCATAACATCCGTTGAGAAGAAGGTTTTCGGGCCAGCTTTCAGGAACCTGACTGAGTTAGATATGCGCTTTAATCCCTTTGATTGCACGTGTGAAAGTATTGCCTGGTTTGTTAATTGGATTAACGAGACCCATACCAACATCCCTGAGCTGTCAAGCCACTACCTTTGCAACACTCCACCTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaoxiao Yu et al.
Cell journal, 22(3), 325-333 (2019-12-22)
This study aimed to evaluate the specific roles of polyinosinic:polycytidylic acid (polyI:C) in macrophage chemotaxis and reveal the potential regulatory mechanisms related to chemokine receptor 5 (CCR5). In this experimental study, THP-1-derived macrophages (THP1-Mφs) induced from THP- 1 monocytes were
Radhashree Maitra et al.
Oncotarget, 8(21), 35138-35153 (2017-04-20)
New therapeutic interventions are essential for improved management of patients with metastatic colorectal cancer (mCRC). This is especially critical for those patients whose tumors harbor a mutation in the KRAS oncogene (40-45% of all patients). This patient cohort is excluded
Maya O Tree et al.
Virology, 497, 81-91 (2016-07-20)
Arboviruses are a large group of viruses that are transmitted by arthropods including ticks and mosquitoes. The global diversity of arboviruses is unknown; however, theoretical studies have estimated that over 2,000 mosquito-borne flaviviruses may exist. An increasing number of flaviviruses
Ye Liu et al.
Journal of cellular biochemistry, 120(6), 9532-9538 (2018-12-07)
To investigate the effect and mechanism of microRNA-186-5p (miR-186-5p) on the apoptosis in high glucose (HG)-treated cardiomyocytes. Diabetic cardiomyopathy model was established in cardiomyocytes by stimulating with HG. The expressions of miR-186-5p and toll-like receptor 3 (TLR3) were detected by
Zengguang Xu et al.
Cancer cell international, 14, 80-80 (2014-01-01)
Therapeutic options for patients with non-small cell lung cancer (NSCLC) are often restricted to systemic chemotherapy. However, the molecular and cellular processes during chemotherapy of advanced NSCLC patients still remain unclear. Here we investigated the stimulatory activity of plasma in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service