Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU210991

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hras1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GATTGGCAGCCGCTGTAGAAGCTATGACAGAATACAAGCTTGTGGTGGTGGGCGCTGGAGGCGTGGGAAAGAGTGCCCTGACCATCCAGCTGATCCAGAACCACTTTGTGGACGAGTATGATCCCACTATAGAGGACTCCTACCGGAAACAGGTGGTCATTGATGGGGAGACATGTCTACTGGACATCTTAGACACAGCAGGTCAAGAAGAGTATAGTGCCATGCGGGACCAGTACATGCGCACAGGGGAGGGCTTCCTCTGTGTATTTGCCATCAACAACACCAAGTCCTTCGAGGACATCCATCAGTACA

Ensembl | Número de adesão de camundongo

ENSMUSG00000025499

nº de adesão NCBI

NM_008284

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... HRAS1(15461) , Hras1(15461)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jagadish Loganathan et al.
International journal of oncology, 44(6), 2009-2015 (2014-04-11)
Breast cancer metastasis is one of the major reasons for the high morbidity and mortality of breast cancer patients. In spite of surgical interventions, chemotherapy, radiation therapy and targeted therapy, some patients are considering alternative therapies with herbal/natural products. In
Fanjie Meng et al.
Oncology reports, 32(5), 2023-2030 (2014-09-06)
Ras mutations contribute to human cancer development. The present study assessed the Ras V12 mutation in hepatocellular carcinoma (HCC) cells and the role of its silencing in vitro and in nude mouse xenografts. HCC BEL7402 cells expressed mutations of V12 (Val/Gly)
Francesco Baschieri et al.
Nature communications, 5, 4839-4839 (2014-09-12)
The small GTPase Cdc42 is a key regulator of polarity, but little is known in mammals about its spatial regulation and the relevance of spatial Cdc42 pools for polarity. Here we report the identification of a GM130-RasGRF complex as a
J Hun Hah et al.
Head & neck, 36(11), 1547-1554 (2013-10-15)
The purpose of this study was to identify mechanisms of innate resistance to an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, erlotinib, in a panel of head and neck squamous cell carcinoma (HNSCC) cell lines. Specifically, we analyzed the
Sushmita Chakraborty et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3852-3860 (2015-03-20)
Leishmania major is a parasite that resides and replicates in macrophages. We previously showed that the parasite enhanced CD40-induced Raf-MEK-ERK signaling but inhibited PI3K-MKK-p38MAPK signaling to proleishmanial effects. As Raf and PI3K have a Ras-binding domain but exert opposite effects

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica