Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU195961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Srebf2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CATTCTGACCACAATGCCTGTGATGATGGGGCAAGAGAAAGTTCCTATCAAGCAAGTGCCTGGCGGCGTGAAGCAGCTGGATCCTCCCAAAGAAGGAGAGAGGCGGACAACACACAATATCATTGAAAAGCGCTACCGGTCCTCCATCAACGACAAAATCATAGAGTTGAAGGACTTAGTCATGGGGACAGATGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATATCTGCAGCAGGTCAATCACAAGCTGCGCCAGGAGAACATGGTGCTGAAGCTGGCCAATCAGAAAAACAAGCTCCTGAAGGGCATCGACCTGGGCAGTCTGGTGGACAGTGATGTGGACTTGAAAATTGATGACTTTAACCAGAATGTCCTTCTGATGTCTCCGCCGGCCTCCGACTCCGGGTCCCAGGCCGGCTTCTCTCCCTATTCCATTGACTCTGAGCCGGGCAGCCCTCTGCTGGATGACGCAAAGGTCAAGGATGAACC

Ensembl | Número de adesão de camundongo

ENSMUSG00000022463

nº de adesão NCBI

NM_033218

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... SREBF2(20788) , Srebf2(20788)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
FMU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Young-Chae Kim et al.
Genome biology, 16, 268-268 (2015-12-05)
Fibroblast growth factor-19 (FGF19) is an intestinal hormone that mediates postprandial metabolic responses in the liver. The unusual orphan nuclear receptor, small heterodimer partner (SHP), acts as a co-repressor for many transcriptional factors and has been implicated in diverse biological
Ji Miao et al.
Nature communications, 6, 6498-6498 (2015-04-08)
Despite the well-documented association between insulin resistance and cardiovascular disease, the key targets of insulin relevant to the development of cardiovascular disease are not known. Here, using non-biased profiling methods, we identify the enzyme flavin-containing monooxygenase 3 (Fmo3) to be
Kazuki Inoue et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 29(8), 1823-1832 (2014-03-29)
Clarification of the mechanisms underlying osteoclast differentiation enables us to understand the physiology of bone metabolism as well as the pathophysiology of bone diseases such as osteoporosis. Recently, it has been reported that epigenetics can determine cell fate and regulate
Kenji Fukui et al.
The Journal of biological chemistry, 290(44), 26383-26392 (2015-09-16)
Diabetes mellitus is associated with a variety of complications, including alterations in the central nervous system (CNS). We have recently shown that diabetes results in a reduction of cholesterol synthesis in the brain due to decreased insulin stimulation of SREBP2-mediated

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica