Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU193121

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Duox1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCTGTGCCTTAACCCAGTACTCATTTCTGGCCACCTCAGCCTTGGCCCTTCCCACCTGCCAACTTGGTTGGTCCAAGTAGCCTCGCTCAGGCATCATGTGTAGGCTCAGAGATCTCTAGGGCCAGAATGTGTCTTGAGTTTGTCGAAGGAGCACTGTTTAAGAACTATAGGTTCAGAAGTAGGGGAGCTTTTGGGTTGAGACAAAGTGAGAATTAAGCAAAAACTTGACAGTAGACAACCTGTCAAGTTTTTGAAAGTGAGTCTGAGTGATAGTATGGATGCTGGCGTCTTCAAGTCCTCTTCACTGTGTTCTTCCTCTCTTCAAAATGGTTGGGAGATGTCTTAGAGTAGCCAGGGGCAACTTACAGAAACCCTCAGGACCAGCCTAACTGAACAACTGATCTCTCAAAATGTAAAATGTAGTCAGACCTTTCTGTGCCCACTAACCGCCTGGAGCAGTGCCCCTCAGCCCCATCTCCCTCTTCTAGTGGTCTGTTTTGCAAATAAACGGTGTTTCCC

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Rabii Ameziane-El-Hassani et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(16), 5051-5056 (2015-04-08)
Ionizing radiation (IR) causes not only acute tissue damage, but also late effects in several cell generations after the initial exposure. The thyroid gland is one of the most sensitive organs to the carcinogenic effects of IR, and we have
Zhimin Feng et al.
Infection and immunity, 82(11), 4458-4465 (2014-08-13)
Currently, Acinetobacter baumannii is recognized as one of the major pathogens seriously threatening our health care delivery system. Aspects of the innate immune response to A. baumannii infection are not yet well understood. Human β-defensins (hBDs) are epithelial cell-derived cationic

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica