Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU185981

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akap11

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCTGGTGTTGTGTGGATTTACTCTCCAGCTACATTACACACTGCAGTAATACAGTTATGGCGGCTTTCCAGCCCCTCAGGAGTAGTCACCTAAAGAGCAAAGCGTCTGTCCGAAAAAGCTTCAGTGAAGATGTGTTCCGGTCTGTAAAGTCTTTATTACAGAGCGAGAAGGAGCTATGCAGTGTATCAGGAGGAGAGTGTTTAAACCAGGATGAGCACCCCCAGTTAACTGAGGTCACGTTTCTGGGCTTTAATGAAGAAACAGATGCTGCTCATATACAGGATCTAGCTGCAGTTTCATTGGAACTTCCAGATCTTCTGAATTCGCTCCATTTTTGCAGTCTAAGTGAAAATGAAATCATTTGTATGAAGGATACCAGTAAATCGTCCAATGTAAGCAGTAGTCCTCTAAATCAGAGTCATCATTCGGGAATGCTTTGTGTCATGAGAGTGTCACCTACATTACCGGGACTCAGAATTGATTTTATCTTTAGTCTCCTAAGTAAATATGCTGCTGGC

Ensembl | Número de adesão de camundongo

ENSMUSG00000022016

nº de adesão NCBI

NM_001164503

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... AKAP11(219181) , Akap11(219181)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Simon A Hinke et al.
The EMBO journal, 31(20), 3991-4004 (2012-09-04)
Endocrine release of insulin principally controls glucose homeostasis. Nutrient-induced exocytosis of insulin granules from pancreatic β-cells involves ion channels and mobilization of Ca(2+) and cyclic AMP (cAMP) signalling pathways. Whole-animal physiology, islet studies and live-β-cell imaging approaches reveal that ablation
Michele E Day et al.
The Journal of cell biology, 193(2), 347-363 (2011-04-20)
Although RII protein kinase A (PKA) regulatory subunits are constitutively localized to discrete cellular compartments through binding to A-kinase-anchoring proteins (AKAPs), RI subunits are primarily diffuse in the cytoplasm. In this paper, we report a novel AKAP-dependent localization of RIα

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica