Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU173171

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Chn1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGAAGATGTCAAGATGGCTTTTGATAGAGATGGTGAGAAGGCGGATATTTCTGTGAACATGTATGAGGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATCTGCCAATTCCTCTCATCACATACGATGCCTACCCCAAGTTCATTGAGTCTGCCAAAATTATGGACCCTGACGAGCAATTGGAGACCCTTCACGAAGCACTGAGATCGCTGCCGCCTGCCCACTGCGAGACGCTCCGGTACCTCATGGCGCATCTCAAGAGAGTGACCCTTCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTTGGACCAACCCTCATGAGATCCCCAGAGCTCG

Ensembl | Número de adesão de camundongo

ENSMUSG00000056486

nº de adesão NCBI

NM_029716

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CHN1(108699) , Chn1(108699)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Junlan Feng et al.
Journal of cellular and molecular medicine, 18(10), 2125-2134 (2014-09-19)
Our previously published study documented a deregulation of the microRNA miR-150 in colorectal cancer. Here, we investigated further, in vitro and in vivo, the potential molecular mechanisms underlying the involvement of miR-150 in colorectal cancer, using the appropriate molecular biological
Chao Zeng et al.
American journal of physiology. Endocrinology and metabolism, 307(4), E384-E397 (2014-07-10)
Activation of conventional PKCs (cPKC) is a key signaling that directs the cardiac toxicity of hyperglycemia. AKAP150, a scaffold protein of the A-kinase anchoring proteins (AKAPs) family, is less defined regarding its capability to anchor and regulate cardiac cPKC signaling.
Han Lin et al.
Molecular and cellular biology, 35(21), 3657-3668 (2015-08-19)
Cdc14 is a phosphatase that controls mitotic exit and cytokinesis in budding yeast. In mammals, the two Cdc14 homologues, Cdc14A and Cdc14B, have been proposed to regulate DNA damage repair, whereas the mitotic exit and cytokinesis rely on another phosphatase
Peng Yang et al.
Cellular signalling, 27(7), 1525-1532 (2015-03-18)
Surgery-induced inflammation has been associated with cancer recurrence and metastasis in colorectal cancer (CRC). As a constituent of gram-negative bacteria, lipopolysaccharide (LPS) is frequently abundant in the peri-operative window. However, the definite roles of LPS in tumour progression remain elusive.
Deguang Xing et al.
Oncology reports, 31(6), 2692-2700 (2014-04-24)
In the present study, we designed and conducted a series of assays to determine the expression of voltage-gated sodium channel (VGSC) neonatal isoform Nav1.5 (nNav1.5) in human brain astrocytoma and its effect on the proliferation, migration, invasion and apoptosis of
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica