Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU150581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Camk2a

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCTGAGAGCACCAACACCACCATTGAGGACGAAGACACCAAAGTGCGCAAACAGGAAATTATCAAAGTGACAGAGCAGCTGATCGAAGCCATAAGCAATGGAGACTTTGAGTCCTACACGAAGATGTGCGACCCTGGAATGACAGCCTTTGAACCAGAGGCCCTGGGGAACCTGGTGGAGGGCCTGGACTTTCATCGATTCTATTTTGAAAACCTGTGGTCCCGGAACAGCAAGCCCGTGCACACCACCATCCTGAACCCTCACATCCACCTGATGGGTGACGAGTCAGCCTGCATCGCCTATATCCGCATCACTCAGTACCTGGATGCAGGCGGCATACCCCGCACGGCCCAGTCAGAGGAGACCCGCGTCTGGCACCGCAGGGACGGCAAATGGCAGATCGTCCACTTCCACAGATCTGGGGCGCCCTCCGTCCTGCCGCATTGAAGGACCAGGCCAGGGTCCCTGCGTCCTTGCTTCGCAGAGATCCGCTCTTTGTCCGTGGAATGT

Ensembl | Número de adesão de camundongo

ENSMUSG00000024617

nº de adesão NCBI

NM_009792

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CAMK2A(12322) , Camk2a(12322)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic
Xueyuan Zhou et al.
Immunology, 143(2), 287-299 (2014-04-30)
Prostaglandin E2 (PGE2 ) is an important inducer of inflammation, which is also closely linked to the progress of tumours. In macrophages, PGE2 production is regulated by arachidonic acid release and cyclooxygenase-2 (COX-2) expression. In the present study, we found
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular
Paul G Daft et al.
PloS one, 10(4), e0121568-e0121568 (2015-04-11)
Osteosarcoma (OS) is a hyperproliferative malignant tumor that requires a high vascular density to maintain its large volume. Vascular Endothelial Growth Factor (VEGF) plays a crucial role in angiogenesis and acts as a paracrine and autocrine agent affecting both endothelial

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica