Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU092131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ube2i

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCCCAACAAAGAACCCTGATGGCACAATGAACCTGATGAACTGGGAGTGCGCTATCCCTGGAAAGAAGGGGACTCCATGGGAAGGAGGCTTGTTCAAGCTACGGATGCTTTTCAAAGATGACTATCCGTCCTCACCACCAAAATGTAAATTTGAGCCCCCACTGTTTCATCCAAACGTGTATCCTTCTGGCACAGTGTGCCTGTCCATCCTGGAGGAAGACAAGGACTGGAGGCCAGCTATCACCATCAAACAGATCTTATTAGGAATACAAGAACTTCTAAATGAACCAAATATTCAAGACCCAGCTCAAGCAGAGGCCTACACAATTTACTGCCAAAACAGAGTGGAATATGAGAAAAGGGTCCGAGCACAAGCGAAGAAGTTTGCCCCCTCATAAGCAGCGGCCCTGGGCTCCATGACGAGGAAGGGATTGGCTTGGCAAGAACTTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000015120

nº de adesão NCBI

NM_011665

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... UBE2I(22196) , Ube2i(22196)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Marcel Kunadt et al.
Acta neuropathologica, 129(5), 695-713 (2015-03-18)
Extracellular α-Synuclein has been implicated in interneuronal propagation of disease pathology in Parkinson's Disease. How α-Synuclein is released into the extracellular space is still unclear. Here, we show that α-Synuclein is present in extracellular vesicles in the central nervous system.
Tanya M Spektor et al.
PloS one, 6(7), e22785-e22785 (2011-08-11)
PR-Set7/Set8/KMT5a is a chromatin-modifying enzyme that specifically monomethylates lysine 20 of histone H4 (H4K20me1). In this study we attempted to identify PR-Set7-interacting proteins reasoning that these proteins would provide important insights into the role of PR-Set7 in transcriptional regulation. Using
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
Faxin Li et al.
Inflammation, 37(4), 1134-1141 (2014-02-18)
Rheumatoid arthritis (RA) is a chronic autoimmune disease with high morbidity and mortality. Fibroblast-like synoviocytes (FLS) in the synovial tissues play critical roles in joint destruction. Recent studies implicate the sumoylation in the regulation of the inflammation and arthritis. Thus

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica