Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU086511

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thpo

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CACAGCTGTCCCAAGCAGTACTTCTCAACTCCTCACACTAAACAAGTTCCCAAACAGGACTTCTGGATTGTTGGAGACGAACTTCAGTGTCACAGCCAGAACTGCTGGCCCTGGACTTCTGAGCAGGCTTCAGGGATTCAGAGTCAAGATTACTCCTGGTCAGCTAAATCAAACCTCCAGGTCCCCAGTCCAAATCTCTGGATACCTGAACAGGACACACGGACCTGTGAATGGAACTCATGGGCTCTTTGCTGGAACCTCACTTCAGACCCTGGAAGCCTCAGACATCTCGCCCGGAGCTTTCAACAAAGGCTCCCTGGCATTCAACCTCCAGGGTGGACTTCCTCCTTCTCCAAGCCTTGCTCCTGATGGACACACACCCTTCCCTCCTTCACCTGCCTTGCCCACCACCCATGGATCTCCACCCCAGCTCCACCCCCTGTTTCCTGACCCTTCCACCACCATGCCTAACTCTACCGCCCCTCATCCAGTCACAATGTACCCTCATCCCAGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000022847

nº de adesão NCBI

NP_033405

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... THPO(21832) , Thpo(21832)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Lina M E Pettersson et al.
PloS one, 9(6), e100730-e100730 (2014-06-27)
Peripheral nerve injury results in dramatic upregulation in pituitary adenylate cyclase activating polypeptide (PACAP) expression in adult rat dorsal root ganglia and spinal motor neurons mirroring that described for the neurotrophin brain derived neurotrophic factor (BDNF). Thus, we posited that
Sae Hyun Park et al.
International journal of oncology, 44(3), 637-646 (2014-01-01)
Fascin1 (FSCN1) involved in cell motility and filopodia assembly plays important roles in biological processes such as cancer invasion and metastasis of multiple epithelial tumors. High-grade serous ovarian carcinoma (HGSOC) is aggressive and metastatic by acquiring an invasive phenotype and
Andres E Perez Bay et al.
Journal of cell science, 127(Pt 20), 4457-4469 (2014-09-03)
Some native epithelia, for example, retinal pigment epithelium (RPE) and kidney proximal tubule (KPT), constitutively lack the basolateral sorting adaptor AP-1B; this results in many basolateral plasma membrane proteins being repositioned to the apical domain, where they perform essential functions
Linn-Karina M Selvik et al.
PloS one, 9(11), e112485-e112485 (2014-11-11)
Salt-inducible kinase 1 (SIK1/Snf1lk) belongs to the AMP-activated protein kinase (AMPK) family of kinases, all of which play major roles in regulating metabolism and cell growth. Recent studies have shown that reduced levels of SIK1 are associated with poor outcome
Peng Zhang et al.
PloS one, 9(5), e97647-e97647 (2014-05-17)
Plasma kisspeptin levels dramatically increased during the first trimester of human pregnancy, which is similar to pregnancy specific glycoprotein-human chorionic gonadotropin. However, its particular role in the implantation and decidualization has not been fully unraveled. Here, the study was conducted
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica