Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU081311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plxnb2

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTCCCTGTATGTGGGCAGTGAGCTGCTGAATTTTGAAGAGACTGTGACCATGCATGAATCAGACACCTTCTCTTTTAGGACCCCAAAGCTATCCCATGATGGTAATGAGACACTGCCTCTTCACCTGTATGTTAAGTCCTTTGGCAAGAACATTGACAGCAAGCTACAAGTGACTCTCTACAACTGCTCCTTTGGCCGCAGTGACTGTAGCCTGTGTCTGGCTGCCGATCCTGCCTACAGGTGTGTGTGGTGCCGTGGGCAGAACCGGTGCGTGTACGAAGCTCTGTGCAGCAATGTCACTTCTGAGTGCCCACCACCAGTTATCACTAGGATCCAGCCTGAGACGGGCCCGCTGGGTGGGGGCATCCTGGTCACTATCCATGGGTCCAATCTGGGTGTCAAAGCAGATGACGTCAAGAAGATAACTGTGGCTGGCCAGAACTGTGCCTTTGAACCAAGAGGGTACTCCG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Audrey P Le et al.
Oncotarget, 6(9), 7293-7304 (2015-03-13)
Invasive growth is a major determinant of the high lethality of malignant gliomas. Plexin-B2, an axon guidance receptor important for mediating neural progenitor cell migration during development, is upregulated in gliomas, but its function therein remains poorly understood. Combining bioinformatic
Daisuke Ito et al.
Journal of immunology (Baltimore, Md. : 1950), 195(3), 934-943 (2015-06-28)
Mammalian target of rapamycin (mTOR) plays crucial roles in activation and differentiation of diverse types of immune cells. Although several lines of evidence have demonstrated the importance of mTOR-mediated signals in CD4(+) T cell responses, the involvement of mTOR in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica