Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU078951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Usp9x

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCCGAGCTATTGATCTCCTTAAAGAGATATACACAAACCTTGGTCCAAGGCTGCAGGTCAATCAGGTGGTGATCCATGAAGACTTCATTCAGTCTTGCTTTGATCGTTTGAAAGCCTCTTATGACACATTGTGTGTTTTGGATGGTGACAAAGACAGTATTAATTGTGCAAGACAGGAAGCTGTTCGAATGGTCCGAGTGTTAACTGTTCTAAGAGAATATATAAATGAATGTGACAGTGATTATCATGAAGAAAGAACAATTTTGCCTATGTCAAGAGCTTTCCGTGGTAAACACCTCTCTTTTATAGTTCGATTTCCAAACCAGGGCAGGCAAGTAGATGACTTGGAGGTTTGGTCTCATACAAATGATACCATTGGTTCAGTTCGAAGATGTATACTCAATCGTATTAAAGCCAATGTAGCTCATACAAAAATTGAACTCTTTGTGGGTGGTGAGC

Ensembl | Número de adesão de camundongo

ENSMUSG00000031010

nº de adesão NCBI

NM_009481

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... USP9X(22284) , Usp9x(22284)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Jesse L Cox et al.
Cancer biology & therapy, 15(8), 1042-1052 (2014-05-21)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and deadly malignancies. Recently, the deubiquitinating protease USP9X has been shown to behave as an oncogene in a number of neoplasms, including those of breast, brain, colon, esophagus and lung
B Wang et al.
Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)
Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse
Deepa Kushwaha et al.
Cancer biology & therapy, 16(3), 392-401 (2015-02-19)
Radiotherapy (RT) is vital for the treatment of locally advanced non-small cell lung cancer (NSCLC), yet its delivery is limited by tolerances of adjacent organs. We sought therefore to identify and characterize gene targets whose inhibition may improve RT. Whole

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica