Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU076311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rela

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TCCATGTCTCACTCCACAGCTGAGCCCATGCTGATGGAGTACCCTGAAGCTATAACTCGCCTGGTGACAGGGTCCCAGAGGCCCCCTGACCCAGCTCCCACACCCCTGGGGACCTCGGGGCTTCCCAATGGTCTCTCCGGAGATGAAGACTTCTCCTCCATTGCGGACATGGACTTCTCTGCTCTTTTGAGTCAGATCAGCTCCTAAGGTGCTGACAGCGACCCTGCTCAGAGCACCAGGTTTCAGGGCACTGAAGCCTTCCCGAAGTGCGTACACATTCTGGGGAGTGTGCTCCAGCTGCCCCCGACTTGTTTGGGTGATCTCTCTGGGGCGGCACGTTTTACTCTTTATCTCGCTTTCGGAGGTGCTTTCGCAGGAGCATTAACCTCCTGGAGACGGAGCTGGGAGGACTCGGTGCATCCCTGTGTTGATAGCTCCTGCTTCGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000024927

nº de adesão NCBI

NM_009045

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... RELA(19697) , Rela(19697)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

12 - Non Combustible Liquids

Classe de risco de água (WGK)

WGK 1

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
VVU
BYS
HQS
DLS
XWR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Martyn K White et al.
PloS one, 9(10), e110122-e110122 (2014-10-14)
The human neurotropic polyomavirus JC (JCV) causes the fatal CNS demyelinating disease progressive multifocal leukoencephalopathy (PML). JCV infection is very common and after primary infection, the virus is able to persist in an asymptomatic state. Rarely, and usually only under
Yun Qu et al.
Cell biochemistry and function, 33(5), 320-325 (2015-07-17)
Nuclear factor-kappaB (NF-κB) is an important transcriptional factor and regulates a variety of pathophysiologic process involved in cell survival and death. This study aimed to assess the effects of NF-κB p65 subunit knockdown in suppression of nude mouse lung tumour
W Zhang et al.
European review for medical and pharmacological sciences, 18(9), 1361-1367 (2014-05-29)
S100A4 is a member of the S100 family of calcium-binding proteins, which possesses a wide range of biological functions, such as regulation of angiogenesis, cell survival, motility, and invasion. Here, we demonstrate for the first time a major role of
Maroof Alam et al.
Oncotarget, 5(9), 2622-2634 (2014-04-29)
The capacity of breast cancer cells to form mammospheres in non-adherent serum-free culture is used as a functional characteristic of the self-renewing stem-like cell population. The present studies demonstrate that silencing expression of the MUC1-C oncoprotein inhibits growth of luminal
Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica