Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU071921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

Ensembl | Número de adesão de camundongo

ENSMUSG00000026104

nº de adesão NCBI

NM_009283

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... STAT1(20846) , Stat1(20846)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift
Chaoyong He et al.
Nature communications, 6, 7770-7770 (2015-07-18)
Platelet-derived growth factor (PDGF) is a mitogen and chemoattractant for vascular smooth muscle cells (VSMCs). However, the direct effects of PDGF receptor β (PDGFRβ) activation on VSMCs have not been studied in the context of atherosclerosis. Here we present a
Shunsuke Fukuyo et al.
Rheumatology (Oxford, England), 53(7), 1282-1290 (2014-03-07)
The mechanisms of ectopic calcification in inflammatory diseases are poorly understood. We investigated the effects of inflammatory cytokines on the mechanisms of calcification in human adipose tissue-derived mesenchymal stem cells (hADSCs). The effects of inflammatory cytokines were evaluated using hADSCs

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica