Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU071351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Src

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACGAGGAAGGTGGATGTCAGAGAGGGAGACTGGTGGCTGGCACACTCGCTGAGCACGGGACAGACCGGTTACATCCCCAGCAACTATGTGGCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTACTTTGGCAAGATCACTAGACGGGAATCAGAGCGGCTGCTGCTCAACGCCGAGAACCCGAGAGGGACCTTCCTCGTGAGGGAGAGTGAGACCACAAAAGGTGCCTACTGCCTCTCTGTATCCGACTTCGACAATGCCAAGGGCCTAAATGTGAAACACTACAAGATCCGCAAGCTGGACAGCGGCGGTTTCTACATCACCTCCCGCACCCAGTTCAACAGCCTGCAGCAGCTCGTGGCTTACTACTCCAAACATGCTGATGGCCTGTGTCACCGCCTCACTACCGTATGTCCCACATCCAAGCCT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

12 - Non Combustible Liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xiaohua Guo et al.
PloS one, 15(4), e0231739-e0231739 (2020-05-01)
We previously reported microvascular leakage resulting from fibrinogen-γ chain C-terminal products (γC) occurred via a RhoA-dependent mechanism. The objective of this study was to further elucidate the signaling mechanism by which γC induces endothelial hyperpermeability. Since it is known that
M Katie Conley-LaComb et al.
Molecular cancer, 15(1), 68-68 (2016-11-05)
The CXCL12/CXCR4 axis transactivates HER2 and promotes intraosseous tumor growth. To further explore the transactivation of HER2 by CXCL12, we investigated the role of small GTP protein G We used a variety of methods such as lipid raft isolation, invasion
Wei Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3033-3046 (2018-02-07)
Hepatitis B virus core protein (HBc) is expressed preferentially in hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC). HBc can function as an oncogene arising from its gene regulatory properties, but how it contributes functionally to hepatocarcinogenesis remains unclear. In this
Jun Wang et al.
Oncotarget, 8(48), 83872-83889 (2017-11-16)
Src has been reported to mediate tissue fibrosis in several organs, but its role in peritoneal fibrosis remains unknown. In this study, we evaluated the therapeutic effect of KX2-391, a highly selective inhibitor of Src, on the development of peritoneal
Yiming Liu et al.
Journal of cellular and molecular medicine, 23(4), 2399-2409 (2019-01-25)
Golgi phosphoprotein 73 (GP73) has been regarded as a novel serum biomarker for the diagnosis of hepatocellular carcinoma (HCC) in recent years. It has been reported that the upregulation of GP73 may promote the carcinogenesis and metastasis of HCC; however

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica