Todas as fotos(1)

Key Documents

EMU067171

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting mouse Xrcc6

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GTCAAGCAAGCTGGAAGACCTGCTAAGGAAGGTTCGAGCCAAGGAGACCAAAAAGCGAGTTCTGTCCAGGTTAAAGTTTAAGCTCGGTGAAGACGTAGTACTCATGGTGGGCATTTATAACTTGGTCCAGAAAGCTAACAAGCCTTTTCCAGTGAGACTCTATCGGGAAACAAATGAACCAGTGAAAACCAAGACAAGGACTTTTAATGTAAACACCGGCAGTCTACTCCTGCCTAGTGACACCAAGCGGTCTCTGACTTACGGGACACGTCAGATTGTGCTGGAGAAAGAGGAGACAGAGGAGCTGAAGCGGTTTGATGAGCCAGGTTTGATCCTCATGGGCTTTAAGCCCACGGTGATGCTGAAGAAGCAGCACTACCTGAGGCCCTCTCTGTTCGTGTACCCAGAGGAGTCCCTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000022471

nº de adesão NCBI

NM_010247

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... XRCC6(14375) , Xrcc6(14375)

Categorias relacionadas

MISSION® esiRNA

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Role of Ku70 in deubiquitination of Mcl-1 and suppression of apoptosis.

B Wang et al.

Cell death and differentiation, 21(7), 1160-1169 (2014-04-29)

Mcl-1 is a unique antiapoptotic Bcl2 family member with a short half-life due to its rapid turnover through ubiquitination. We discovered that Ku70, a DNA double-strand break repair protein, functions as a deubiquitinase to stabilize Mcl-1. Ku70 knockout in mouse

Alternative splicing of FBP-interacting repressor coordinates c-Myc, P27Kip1/cyclinE and Ku86/XRCC5 expression as a molecular sensor for bleomycin-induced DNA damage pathway.

Bahityar Rahmutulla et al.

Oncotarget, 5(9), 2404-2417 (2014-05-09)

The far-upstream element-binding protein-interacting repressor (FIR) is a c-myc transcriptional suppressor. FIR is alternatively spliced to lack the transcriptional repression domain within exon 2 (FIRΔexon2) in colorectal cancers. FIR and FIRΔexon2 form homo- or heterodimers that complex with SAP155. SAP155

Ku70 is essential for histone deacetylase inhibitor trichostatin A-induced apoptosis.

Jin Meng et al.

Molecular medicine reports, 12(1), 581-586 (2015-02-20)

It was previously reported that the histone deacetylase inhibitor (HDACI) trichostatin A (TSA) induced B cell lymphoma 2 (Bcl-2)-associated X protein (Bax)-dependent apoptosis in colorectal cancer (CRC) cells. In addition, Ku70 has been identified as a regulator of apoptosis, the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica