Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU063061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse C3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GACGCCACTATGTCCATCCTGGACATCTCCATGATGACTGGCTTTGCTCCAGACACAAAGGACCTGGAACTGCTGGCCTCTGGAGTAGATAGATACATCTCCAAGTACGAGATGAACAAAGCCTTCTCCAACAAGAACACCCTCATCATCTACCTAGAAAAGATTTCACACACCGAAGAAGACTGCCTGACCTTCAAAGTTCACCAGTACTTTAATGTGGGACTTATCCAGCCCGGGTCGGTCAAGGTCTACTCCTATTACAACCTCGAGGAATCATGCACCCGGTTCTATCATCCAGAGAAGGACGATGGGATGCTCAGCAAGCTGTGCCACAGTGAAATGTGCCGGTGTGCTGAAGAGAACTGCTTCATGCAACAGTCACAGGAGAAGATCAACCTGAATGTCCGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000024164

nº de adesão NCBI

NM_009778

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... C3(12266) , C3(12266)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
WNS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Eva-Maria Nichols et al.
Kidney international, 88(6), 1314-1322 (2015-07-30)
Abnormal regulation of the complement alternative pathway is associated with C3 glomerulopathy. Complement factor H is the main plasma regulator of the alternative pathway and consists of 20 short consensus repeat (SCR) domains. Although recombinant full-length factor H represents a
Hiroyuki Inoshita et al.
PloS one, 8(11), e78736-e78736 (2013-11-14)
The link between glomerular IgA nephropathy (IgAN) and T helper 2 (Th2) response has been implicated, however, the mechanisms are poorly defined because of the lack of an appropriate model. Here we report a novel murine model characterized by lineage-restricted
Manuela Veglia et al.
American journal of reproductive immunology (New York, N.Y. : 1989), 74(6), 542-552 (2015-09-22)
A threefold higher prevalence of antinuclear antibodies (ANA) has been reported in patients with recurrent pregnancy loss (RPL). Nevertheless, the role of ANA in reproductive failure is still unclear. The aim of this study was to investigate the role of
Maria I Fonseca et al.
Journal of neuroinflammation, 8(1), 4-4 (2011-01-18)
Complement proteins and activation products have been found associated with neuropathology in Alzheimer's disease (AD). Recently, a C5a receptor antagonist was shown to suppress neuropathology in two murine models of AD, Tg2576 and 3xTg. Previously, a genetic deficiency of C1q
Masanori A Murayama et al.
Nature communications, 6, 8483-8483 (2015-09-26)
The complement system is important for the host defence against infection as well as for the development of inflammatory diseases. Here we show that C1q/TNF-related protein 6 (CTRP6; gene symbol C1qtnf6) expression is elevated in mouse rheumatoid arthritis (RA) models.
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica