Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU060801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stk11

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GAGAGGCCAACGTCAAGAAGGAGATCCAGCTGCTGCGGCGGCTGCGGCATCGGAATGTGATCCAGCTTGTGGACGTGCTGTACAATGAGGAGAAGCAGAAGATGTATATGGTGATGGAGTACTGCGTATGTGGCATGCAGGAGATGCTGGACAGTGTGCCGGAGAAGCGCTTCCCTGTGTGCCAAGCTCATGGGTACTTCCGCCAGCTGATTGACGGCCTGGAATACCTACACAGCCAGGGCATTGTTCACAAGGACATCAAGCCGGGCAACCTGCTACTCACCACCAATGGCACACTCAAGATCTCCGACCTCGGTGTTGCCGAGGCCCTGCACCCTTTCGCTGTGGATGACACCTGCCGGACAAGCCAGGGCTCCCCGGCCTTCCAGCCTCCTGAGATTG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Fanny Dupuy et al.
Cancer & metabolism, 1(1), 18-18 (2013-11-28)
Germline and somatic mutations in STK11, the gene encoding the serine/threonine kinase LKB1, are strongly associated with tumorigenesis. While loss of LKB1 expression has been linked to breast cancer, the mechanistic role of LKB1 in regulating breast cancer development, metastasis
Ngai Na Co et al.
Cancer, 120(22), 3457-3468 (2014-07-22)
Liver kinase B1 (LKB1) is a serine/threonine kinase that functions as a tumor suppressor and regulates cell polarity, proliferation, and metabolism. Mutations in LKB1 are associated with Peutz-Jeghers syndrome as well as sporadic cervical and lung cancers. Although LKB1-null mice
Juan Li et al.
Journal of experimental & clinical cancer research : CR, 33, 70-70 (2014-09-03)
LKB1, also known as STK11, is a master kinase that serves as an energy metabolic sensor and is involved in cell polarity regulation. Recent studies have indicated that LKB1 is related to breast tumorigenesis and breast cancer progression. However, little
Kaisheng Mao et al.
Lung cancer (Amsterdam, Netherlands), 88(2), 131-138 (2015-03-15)
The tumor suppressor LKB1 has recently been shown to be involved in the regulation of microtubule dynamics, thus cancer cells with inactivated LKB1 may have developed a means to overcome dysregulated microtubule functions, making them intrinsically resistant to microtubule targeting
Shabnam Pooya et al.
Nature communications, 5, 4993-4993 (2014-09-27)
A prerequisite to myelination of peripheral axons by Schwann cells (SCs) is SC differentiation, and recent evidence indicates that reprogramming from a glycolytic to oxidative metabolism occurs during cellular differentiation. Whether this reprogramming is essential for SC differentiation, and the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica