Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU047141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il1rl1

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ATTGCCTGTTCAGCTTGCTTTGGCAAAGGCTCTCACTTCTTGGCTGATGTCCTGTGGCAGATTAACAAAACAGTAGTTGGAAATTTTGGTGAAGCAAGAATTCAAGAAGAGGAAGGTCGAAATGAAAGTTCCAGCAATGACATGGATTGTTTAACCTCAGTGTTAAGGATAACTGGTGTGACAGAAAAGGACCTGTCCCTGGAATATGACTGTCTGGCCCTGAACCTTCATGGCATGATAAGGCACACCATAAGACTGAGAAGGAAACAACCAAGTAAGGAGTGTCCCTCACACATTGCTTGAATAAATTGGCTGAATCAGCTGTGCACTGCATCCGTTTTCTCCGAGGACTGTGTGTTGTAGCTTGGTCCCAGGGAATCCATCATGATCAAGGGAATAGTTGGCCTG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33
S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica