Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU046421

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Traf6

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TTTCCCTGACGGTAAAGTGCCCAAATAAAGGCTGTTTGCAAAAGATGGAACTGAGACATCTCGAGGATCATCAAGTACATTGTGAATTTGCTCTAGTGAATTGTCCCCAGTGCCAACGTCCTTTCCAGAAGTGCCAGGTTAATACACACATTATTGAGGATTGTCCCAGGAGGCAGGTTTCTTGTGTAAACTGTGCTGTGTCCATGGCATATGAAGAGAAAGAGATCCATGATCAAAGCTGTCCTCTGGCAAATATCATCTGTGAATACTGTGGTACAATCCTCATCAGAGAACAGATGCCTAATCATTATGATCTGGACTGCCCAACAGCTCCAATCCCTTGCACATTCAGTGTTTTTGGCTGTCATGAAAAGATGCAGAGGAATCACTTGGCACGACACTTG

Ensembl | Número de adesão de camundongo

ENSMUSG00000027164

nº de adesão NCBI

NM_009424

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... TRAF6(22034) , Traf6(22034)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
DBT
QXS
BHS
AOR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Melinda E Varney et al.
The Journal of experimental medicine, 212(11), 1967-1985 (2015-10-16)
TRAF-interacting protein with forkhead-associated domain B (TIFAB) is a haploinsufficient gene in del(5q) myelodysplastic syndrome (MDS). Deletion of Tifab results in progressive bone marrow (BM) and blood defects, including skewed hematopoietic stem/progenitor cell (HSPC) proportions and altered myeloid differentiation. A
Frank Secreto et al.
Leukemia & lymphoma, 55(8), 1884-1892 (2013-11-12)
B-cell activating factor-receptor (BAFF-R) is the primary BAFF receptor that is responsible for promoting B-cell development and survival. Malignant B-cells exploit the BAFF/BAFF-R system, and high serum BAFF levels or genetic alterations in BAFF receptors have been found in B-cell
Domenico Somma et al.
Journal of immunology (Baltimore, Md. : 1950), 194(7), 3286-3294 (2015-02-25)
IL-17 is a proinflammatory cytokine that promotes the expression of different cytokines and chemokines via the induction of gene transcription and the posttranscriptional stabilization of mRNAs. In this study, we show that IL-17 increases the half-life of the Zc3h12a mRNA

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica