Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU043271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rrm2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCACTGGGAAGCTCTGAAACCCGATGAGAGACATTTTATATCTCACGTTCTGGCTTTCTTTGCAGCGAGTGATGGCATAGTCAATGAGAACTTGGTGGAGCGATTTAGCCAAGAAGTTCAAGTTACAGAGGCCCGCTGTTTCTATGGCTTCCAAATTGCCATGGAAAACATACACTCTGAAATGTACAGTCTCCTTATTGACACTTACATTAAAGATCCCAAGGAAAGAGAATATCTCTTCAATGCTATTGAAACTATGCCTTGTGTGAAGAAGAAGGCTGACTGGGCCTTGCGCTGGATTGGGGACAAAGAGGCTACGTATGGAGAACGCGTTGTGGCCTTTGCCGCCGTAGAAGGAATCTTCTTTTCCGGTTCTTTTGCATCGATATTCTGGCTCAAGAAACGGGGGCTGATGCCGGGCCTTACATTTTCCAATGAGCTTATTAGCAGAGACGAGGGTTTACACTGTGACTTTGCCTGCCTGATGTTCAAGCACCTGGTACACAAGCCAGCGGAGCAGAGGGTCCGAGAGATAATCACCAACGCCG

Ensembl | Número de adesão de camundongo

ENSMUSG00000020649

nº de adesão NCBI

NM_009104

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... RRM2(20135) , Rrm2(20135)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Zejun Fang et al.
Biochemical and biophysical research communications, 464(2), 407-415 (2015-06-21)
As the ribonucleotide reductase small subunit, the high expression of ribonucleotide reductase small subunit M2 (RRM2) induces cancer and contributes to tumor growth and invasion. In several colorectal cancer (CRC) cell lines, we found that the expression levels of RRM2
Nagireddy Putluri et al.
Neoplasia (New York, N.Y.), 16(5), 390-402 (2014-07-14)
Breast cancer (BCa) molecular subtypes include luminal A, luminal B, normal-like, HER-2-enriched, and basal-like tumors, among which luminal B and basal-like cancers are highly aggressive. Biochemical pathways associated with patient survival or treatment response in these more aggressive subtypes are
Kazuki Iwamoto et al.
International journal of oncology, 46(5), 1971-1977 (2015-03-05)
In our previous study, ribonucleotide reductase M2 (RRM2) was identified as a cancer-related gene commonly overexpressed in human oral squamous cell carcinoma (OSCC) cell lines. Herein, we attempted to determine whether targeting RRM2 may be a plausible therapeutic approach for
Rong Zhou et al.
Acta pharmacologica Sinica, 35(11), 1375-1384 (2014-09-30)
Ryanodine receptor 2 (RyR2) is a critical component of intracellular Ca(2+) signaling in vascular smooth muscle cells (VSMCs). The aim of this study was to investigate the role of RyR2 in abnormal vascular reactivity after hemorrhagic shock in rats. SD

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica