Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU043231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fyn

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACAGCTCCTGTCCTTTGGAAACCCAAGAGGTACCTTTCTTATCCGCGAGAGCCAAACCACCAAAGGTGCCTACTCACTTTCCATCCGTGATTGGGATGATATGAAAGGGGACCACGTCAAACATTATAAAATCCGCAAGCTTGACAATGGTGGATACTATATCACAACGCGGGCCCAGTTTGAAACACTTCAGCAACTGGTACAGCATTACTCAGAGAAAGCTGATGGTTTGTGTTTTAACTTAACTGTGGTTTCATCAAGTTGTACCCCACAAACTTCTGGATTGGCTAAAGATGCTTGGGAAGTTGCACGTGACTCGTTGTTTCTGGAGAAGAAGCTGGGGCAGGGGTGTTTCGCTGAAGTGTGGCTTGGTACCTGGAATGGAAATACAAAAGTAGCCATAAAGACCCTTAAGCCAGGCACCATGTCTCCGGAGTCCTTCCTGGAGGAGGCGCAGATCATGAAGAAGCTGAAGCATGACAAGCTGGTGCAGCTCTACGCGGTCGTGTCTGAGGAGCCCATTTACATCGTCACGGAGTACATGAGC

Ensembl | Número de adesão de camundongo

ENSMUSG00000019843

nº de adesão NCBI

NM_008054

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... FYN(14360) , Fyn(14360)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Michaela Nelson et al.
International journal of cancer, 135(10), 2338-2351 (2014-04-15)
Voltage-gated Na(+) channels (VGSCs) are heteromeric proteins composed of pore-forming α subunits and smaller β subunits. The β subunits are multifunctional channel modulators and are members of the immunoglobulin superfamily of cell adhesion molecules (CAMs). β1, encoded by SCN1B, is
Nikhil Panicker et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 35(27), 10058-10077 (2015-07-15)
Sustained neuroinflammation mediated by resident microglia is recognized as a key pathophysiological contributor to many neurodegenerative diseases, including Parkinson's disease (PD), but the key molecular signaling events regulating persistent microglial activation have yet to be clearly defined. In the present
Hadas Grossman et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 29(8), 3206-3216 (2015-04-30)
Granulosa cells support the developing oocytes and serve as transducers of the ovulatory stimulus induced by LH surge. Fyn kinase is expressed in granulosa cells, though its role in these cells has not been studied. In human embryonic kidney 293T

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica