Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU039641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptgs2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

ATCCTGAGTGGGGTGATGAGCAACTATTCCAAACCAGCAGACTCATACTCATAGGAGAGACTATCAAGATAGTGATCGAAGACTACGTGCAACACCTGAGCGGTTACCACTTCAAACTCAAGTTTGACCCAGAGCTCCTTTTCAACCAGCAGTTCCAGTATCAGAACCGCATTGCCTCTGAATTCAACACACTCTATCACTGGCACCCCCTGCTGCCCGACACCTTCAACATTGAAGACCAGGAGTACAGCTTTAAACAGTTTCTCTACAACAACTCCATCCTCCTGGAACATGGACTCACTCAGTTTGTTGAGTCATTCACCAGACAGATTGCTGGCCGGGTTGCTGGGGGAAGAAATGTGCCAATTGCTGTACAAGCAGTGGCAAAGGCCTCCATTGACCAGAGCAGAGAGATGAAATACCAGTCTCTCAATGAGTACCGGAAACGCTTCTCCCTGAAGCCGTACACATCATTTGAAGAACTTACAGGAGAGAAGGAAATGGCTGCAGAA

Ensembl | Número de adesão de camundongo

ENSMUSG00000032487

nº de adesão NCBI

NM_011198

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... PTGS2(19225) , Ptgs2(19225)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mei Ming et al.
Cancer research, 74(20), 5925-5933 (2014-10-17)
SIRT6 is a SIR2 family member that regulates multiple molecular pathways involved in metabolism, genomic stability, and aging. It has been proposed previously that SIRT6 is a tumor suppressor in cancer. Here, we challenge this concept by presenting evidence that
Yan Zhao et al.
International journal of clinical and experimental pathology, 8(4), 3719-3726 (2015-06-23)
Cyclooxygenase2 (Cox-2) is well known for glioma growth through up-regulation of prostaglandin E2 (PGE2) levels. MET, a hepatocyte growth factor (HGF) receptor, is also frequently high expressed in glioma, which promotes glioma growth and invasion. Here, we demonstrate that HGF/MET
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of
Qiang Bu et al.
Molecular medicine reports, 10(4), 2203-2209 (2014-08-12)
Alterations in microRNA (miRNA) expression have been shown to be involved in the tumor response to chemotherapy. However, the possible role of miR‑101 in cisplatin sensitivity in human bladder cancer cells remains unclear. In this study, quantitative polymerase chain reaction
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica