Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU039131

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Plk1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCTACAGCAGCTGACCAGTGTCAACGCCTCCAAGCCCTCGGAGCGCGGGCTGGTGCGGCAAGAGGAGGCTGAGGATCCTGCCTGCATCCCCATCTTCTGGGTCAGCAAGTGGGTGGACTATTCGGACAAGTATGGCCTTGGGTATCAGCTGTGTGACAACAGTGTGGGGGTGCTTTTTAATGACTCAACACGCCTGATTCTCTACAATGACGGGGACAGCCTGCAGTACATAGAGCGTGATGGCACGGAGTCCTATCTCACTGTGAGCTCCCATCCCAATTCCTTGATGAAGAAGATCACTCTCCTCAACTATTTCCGCAATTACATGAGTGAGCACCTGCTGAAGGCAGGACGCAACATCACACCCCGGGAAGGCGACGAGCTGGCCCGGCTGCCCTACCTACGAACGTGGTTCCGCACACGCAGCGCCATCATCCTGCACCTCAGCAACGGCACCGTGCAGATTAACTTCTTCCAGGACCACACCAAACTTATCCTGTGCCCCCT

Ensembl | Número de adesão de camundongo

ENSMUSG00000030867

nº de adesão NCBI

NM_011121

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... PLK1(18817) , Plk1(18817)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Riet van der Meer et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(12), 3211-3221 (2014-04-29)
To identify genes whose depletion is detrimental to Pim1-overexpressing prostate cancer cells and to validate this finding in vitro and in vivo. RNAi screening was used to identify genes whose depletion is detrimental to Pim1-overexpressing cells. Our finding was validated
Valentina Zuco et al.
Oncotarget, 6(11), 8736-8749 (2015-04-01)
Intrinsic and acquired tumor drug resistance limits the therapeutic efficacy of camptothecins (CPTs). Downregulation of the mitotic kinase PLK1 was found associated with apoptosis induced by SN38 (CPT11 active metabolite). We investigated the role of PLK1 in the cell response
Hui Tian et al.
Molecular cancer research : MCR, 13(4), 784-794 (2015-01-13)
Protein S-palmitoylation is a widespread and dynamic posttranslational modification that regulates protein-membrane interactions, protein-protein interactions, and protein stability. A large family of palmitoyl acyl transferases, termed the DHHC family due to the presence of a common catalytic motif, catalyzes S-palmitoylation;
Sixin Jiang et al.
Respiratory research, 16, 93-93 (2015-08-06)
Polo-like kinase 1 (Plk1) is a serine/threonine protein kinase that has been implicated in the regulation of mitosis. In addition, the activation of mitogen-activated protein kinase (MAPK) is a key event in the early stage of the growth factor response.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica