Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU038061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atg5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTCGAGATGTGTGGTTTGGACGAATTCCAACTTGCTTTACTCTCTATCAGGATGAGATAACTGAAAGAGAAGCAGAACCATACTATTTGCTTTTGCCAAGAGTCAGCTATTTGACGTTGGTAACTGACAAAGTGAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGATGTTAGTGAGATATGGTTTGAATATGAAGGCACACCCCTGAAATGGCATTATCCAATTGGTTTACTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTCAAGAGTTTTCCAGAAAAGGACCTTCTACACTGTCCATCCAAGGATGCGGTTGAGGCTCACTTTATGTCGTGTATGAAAGAAGCTGATGCTTTAAAGCATAAAAGTCAAGTGATCAACGAAATGCAGAAAAAAGACCACAAGCAGCTCTGGATGGGACTGCAGAATGACAGATTTGACCAGTTTTGGGCCATCAACCGGAAACTCATGGAAT

Ensembl | Número de adesão de camundongo

ENSMUSG00000038160

nº de adesão NCBI

NM_053069

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... ATG5(11793) , Atg5(11793)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Zhiqiang Liu et al.
Oncotarget, 6(33), 34329-34341 (2015-10-13)
A major problem in patients with multiple myeloma is chemotherapy resistance, which develops in myeloma cells upon interaction with bone marrow stromal cells. However, few studies have determined the role of bone marrow adipocytes, a major component of stromal cells
Rongsong Li et al.
Antioxidants & redox signaling, 23(15), 1207-1219 (2015-06-30)
Temporal and spatial variations in shear stress are intimately linked with vascular metabolic effects. Autophagy is tightly regulated in intracellular bulk degradation/recycling system for maintaining cellular homeostasis. We postulated that disturbed flow modulates autophagy with an implication in mitochondrial superoxide
Mark Thomas et al.
Frontiers in cell and developmental biology, 8, 565915-565915 (2020-11-13)
Many clinical trials are beginning to assess the effectiveness of compounds known to regulate autophagy in patients receiving anti-cancer chemotherapy. However, autophagy inhibition, through exogenous inhibitors, or activation, through starvation, has revealed conflicting roles in cancer management and chemotherapeutic outcome.
Qun Wu et al.
PloS one, 10(4), e0124524-e0124524 (2015-04-17)
Human rhinovirus (HRV) is the most common cause of acute exacerbations of chronic lung diseases including asthma. Impaired anti-viral IFN-λ1 production and increased HRV replication in human asthmatic airway epithelial cells may be one of the underlying mechanisms leading to
Hongming Pan et al.
Scientific reports, 4, 6683-6683 (2014-10-21)
Autophagy is a critical survival pathway for cancer cells under conditions of stress. Thus, induction of autophagy has emerged as a drug resistance mechanism. This study is to determine whether autophagy is activated by a novel multikinase inhibitor linifanib, thereby
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica