Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU037541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Marcks

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GACCCCGCATCTTATTAGCAACCAGGGAGATTTCTCCATTTTCCTCTTGTCTACAGTGCGGCTACAAATCTGGGATTTTTTTTTATTACTTCTTTTTTTAAAAAAACTACACTTGGGCTCCTTTTTTGTGCTCGACTTTTCCACCTTTTTCCCTCCTTCCTGCGCTGCTGCTTTTTTGATCTCTTCGACTAAAAATTTTTTATCCGGAGTATTTAATCGGGTCTCTTCTGTCCTCCTCGCCACCCCCACCCCCTCCCTCCGGTGTGTGTGCCGCCGCCGCTGTTGCTGCTGCTGCTGCTCGCCCCGTCGTTACACCAACCGAAGGCTCTTTGTTTCCTCTCTTGGATCTGTTGAGTTTCTTTGTTGAAGAAGCCAGCATGGGTGCCCAGTTCTCCAAGACCGCAGCGAAGGGAGAAGCCACCGCCGAGAGGCCCGGGGAGGCGGCTGTGGCCTCGTCGCCTTCCAAAGCAAATGGGCAGGAGAATGGCCACGTAAAA

Ensembl | Número de adesão de camundongo

ENSMUSG00000069662

nº de adesão NCBI

NM_008538

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... MARCKS(17118) , Marcks(17118)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ching-Hsien Chen et al.
Oncotarget, 6(17), 15194-15208 (2015-05-28)
Accumulating evidence has suggested that myristoylated alanine-rich C-kinase substrate (MARCKS) is critical for regulating multiple pathophysiological processes. However, the molecular mechanism underlying increased phosphorylation of MARCKS at Ser159/163 (phospho-MARCKS) and its functional consequence in neoplastic disease remain to be established.
C-H Chen et al.
Oncogene, 33(28), 3696-3706 (2013-08-21)
Myristoylated Alanine-Rich C Kinase Substrate (MARCKS), a substrate of protein kinase C, is a key regulatory molecule controlling mucus granule secretion by airway epithelial cells as well as directed migration of leukocytes, stem cells and fibroblasts. Phosphorylation of MARKCS may
Dan Yu et al.
Journal of the American Heart Association, 4(10), e002255-e002255 (2015-10-10)
Transcription of the myristoylated alanine-rich C kinase substrate (MARCKS) is upregulated in animal models of intimal hyperplasia. MARCKS knockdown inhibits vascular smooth muscle cell (VSMC) migration in vitro; however, the mechanism is as yet unknown. We sought to elucidate the

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica