Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU037431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Syp

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGTGGGTCTTTGCCATCTTCGCCTTTGCTACGTGCGGCAGCTACACCGGAGAGCTTCGGCTGAGCGTGGAGTGTGCCAACAAGACGGAGAGTGCCCTCAACATCGAAGTCGAATTTGAGTACCCATTCAGGCTGCACCAAGTGTACTTTGATGCACCCTCCTGCGTTAAAGGGGGCACTACCAAGATCTTCCTAGTTGGTGACTACTCCTCCTCGGGTGAATTCTTTGTCACCGTGGCTGTGTTTGCCTTCCTCTACTCCATGGGGGCCCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAACAACAAAGGGCCAATGATGGACTTCCTGGCCACAGCAGTGTTCGCTTTCATGTGGCTAGTTAGCTCATCCGCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCCACTGACCCAGAGAACATTATCAAGGAGATGCCTATGTGCCGCCAGACAGGAAACACATGCAAGGAACTGAGGGACCCTGT

Ensembl | Número de adesão de camundongo

ENSMUSG00000031144

nº de adesão NCBI

NM_009305

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... SYP(20977) , Syp(20977)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular
K S Siveen et al.
British journal of cancer, 111(7), 1327-1337 (2014-08-08)
Constitutive activation of signal transducer and activator of transcription signalling 3 (STAT3) has been linked with survival, proliferation and angiogenesis in a wide variety of malignancies including hepatocellular carcinoma (HCC). We evaluated the effect of lupeol on STAT3 signalling cascade

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica