Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU034531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dand5

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCACCCCTGTAGTCTTCTGCAACAGCTGTGTGCCGGCTCGAAAGCGCTGGACATCGGTGACGCTGTGGTGTGGAGCTGGCCAATTAGCCTCCCCTCGGCGGGTGAGGATTTCCACGGTATTGGTCCAGAAGTGTCAGTGCCGCCCGAAGCTGTGAGCTGAGCATCCTAGAGGAATGCGCAGGACATGAATGAACCTTGGCAAGAAGCAGGAGACGCAATAGAAAGACGTGACCTGAATGATGTGCATCGGGTCAAGAGAGCAGAATTGGACAGGGCCAGAATACTAGACATGGTCCCCCAGTCATGGGTTTAGACCACTAATAGTCGTAGAATGTGGGGCTAGGGTATAACTCAGTGGGAGAGGGCTTGCCTAGCATGCATGAAGCCCTGGGTTCTATTCGTATGTGATATGTGGAGGTTAAAAAAAGGTGAAAATTAGCTATAGTGTATGATTAGCCCTGTGTGAGAGGGAACATTCATGCCAC

Ensembl | Número de adesão de camundongo

ENSMUSG00000053226

nº de adesão NCBI

NM_201227

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... DAND5(23863) , Dand5(23863)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Kazuo Asanoma et al.
Molecular and cellular biology, 35(24), 4096-4109 (2015-09-24)
BHLHE40 and BHLHE41 (BHLHE40/41) are basic helix-loop-helix type transcription factors that play key roles in multiple cell behaviors. BHLHE40/41 were recently shown to be involved in an epithelial-to-mesenchymal transition (EMT). However, the precise mechanism of EMT control by BHLHE40/41 remains
Li Yan et al.
American journal of cancer research, 5(4), 1447-1459 (2015-06-24)
Recent evidence suggests that miR-520 family has an important role in regulating tumorigenesis and development of various types of solid cancers. However, as one of the most common cancers in the world, there is little known about the underlying regulatory
Sumegha Mitra et al.
PloS one, 9(6), e100169-e100169 (2014-06-19)
Growth arrest DNA damage inducible alpha (GADD45a) is a stress-induced gene we have shown to participate in the pathophysiology of ventilator-induced lung injury (VILI) via regulation of mechanical stress-induced Akt ubiquitination and phosphorylation. The regulation of GADD45a expression by mechanical
Pablo Secades et al.
Head & neck, 37(8), 1150-1162 (2014-05-07)
We previously showed that activation of epidermal growth factor receptor (EGFR) induces hypoxia inducible factor-1α (HIF-1α) in head and neck squamous cell carcinoma (HNSCC) cells. In this study, we have furthered this by investigating the mechanism of HIF-1α activation by

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica