Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU028961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hpse

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGAGCTCTGATGTGCTGGACACTTTTATTCTCTCTGTGCAAAAAATTCTGAAGGTCACTAAAGAGATCACACCTGGCAAGAAGGTCTGGTTGGGAGAGACGAGCTCAGCTTACGGTGGCGGTGCACCCTTGCTGTCCAACACCTTTGCAGCTGGCTTTATGTGGCTGGATAAATTGGGCCTGTCAGCCCAGATGGGCATAGAAGTCGTGATGAGGCAGGTGTTCTTCGGAGCAGGCAACTACCACTTAGTGGATGAAAACTTTGAGCCTTTACCTGATTACTGGCTCTCTCTTCTGTTCAAGAAACTGGTAGGTCCCAGGGTGTTACTGTCAAGAGTGAAAGGCCCAGACAGGAGCAAACTCCGAGTGTATCTCCACTGCACTAACGTCTATCACCCACGATATCAGGAAGGAGATCTAACTCTGTATGTCCTGAACCTCCATAATGTCACCAAGCACTTGAAGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000035273

nº de adesão NCBI

NM_152803

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... HPSE(15442) , Hpse(15442)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Haiyan Zheng et al.
Cancer biomarkers : section A of Disease markers, 15(5), 525-534 (2015-01-15)
Heparanase(HPSE), an endo-β -D-glucuronidase, is found overexpressed in Ovarian cancer (OC). The purpose of our work was to investigate primitively the possible role of HPSE in the development of OC. In this study, RNA interference (RNAi) with a HPSE small
Satvik R Hadigal et al.
Nature communications, 6, 6985-6985 (2015-04-29)
Herpesviruses exemplified by herpes simplex virus-1 (HSV-1) attach to cell surface heparan sulfate (HS) for entry into host cells. However, during a productive infection, the HS moieties on parent cells can trap newly exiting viral progenies and inhibit their release.

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica