Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU028161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc2a

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

Ensembl | Número de adesão de camundongo

ENSMUSG00000019942

nº de adesão NCBI

NP_031685

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CDC2A(12534) , Cdc2a(12534)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Gunjan Guha et al.
PloS one, 10(5), e0125322-e0125322 (2015-05-06)
Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and
Qinghua Xi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 4939-4948 (2015-04-26)
Overexpression of cyclin-dependent kinase 1 (CDK1) has been noted to correlation with several human cancers. However, the effects of CDK1 on ovarian cancer development remain unclear. The aim of this study was to examine the effect of CDK1 and related
Qing Xia et al.
International journal of oncology, 44(3), 735-744 (2014-01-01)
Breast cancer is one of the most common malignancies in women. Approximately 15% of the patients belong to the triple-negative breast cancer (TNBC) group, and have the disadvantage of not benefiting from currently available receptor-targeted systemic therapies. Some cancers in

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica