Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EMU026621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cyr61

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

AGACCCGGATCTGTGAAGTGCGTCCTTGTGGACAACCAGTGTACAGCAGCCTAAAAAAGGGCAAGAAATGCAGCAAGACCAAGAAATCCCCAGAACCAGTCAGATTTACTTATGCAGGATGCTCCAGTGTCAAGAAATACCGGCCCAAATACTGCGGCTCCTGCGTAGATGGCCGGTGCTGCACACCTCTGCAGACCAGAACTGTGAAGATGCGGTTCCGATGCGAAGATGGAGAGATGTTTTCCAAGAATGTCATGATGATCCAGTCCTGCAAATGTAACTACAACTGCCCGCATCCCAACGAGGCATCGTTCCGACTGTACAGCCTATTCAATGACATCCACAAGTTCAGGGACTAAGTGCCTCCAGGGTTCCTAGTGTGGGCTGGACAGAGGAGAAGCGCAAGCATCATGGAGACGTGGGTGGGCGGAGGATGAATGGTGCCTTGCTCATTCTT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hemabindu Chintala et al.
Development (Cambridge, England), 142(13), 2364-2374 (2015-05-24)
Physiological angiogenesis depends on the highly coordinated actions of multiple angiogenic regulators. CCN1 is a secreted cysteine-rich and integrin-binding matricellular protein required for proper cardiovascular development. However, our understanding of the cellular origins and activities of this molecule is incomplete.
Yu Di et al.
Drug design, development and therapy, 9, 2463-2473 (2015-05-23)
CCN1 (also called Cyr 61) is an extracellular matrix signaling molecule that has been implicated in neovascularization through its interactions with several endothelial integrin receptors. The roles of vascular endothelial growth factor (VEGF) in angiogenesis are well described. The aim

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica