Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU026071

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Axl

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGGTACCGTGTCCGAAAGTCCTACAGCCGGCGGACCACTGAAGCCACCTTGAACAGTCTGGGCATCAGTGAAGAGCTGAAGGAGAAACTACGAGACGTCATGGTAGATCGGCATAAGGTGGCCTTGGGGAAGACCCTGGGAGAAGGAGAATTTGGCGCTGTGATGGAAGGTCAGCTCAATCAGGATGACTCCATCCTCAAGGTCGCTGTGAAGACCATGAAAATTGCCATCTGCACAAGATCAGAGCTGGAGGATTTCCTGAGTGAAGCTGTCTGCATGAAGGAATTTGACCACCCCAACGTCATGAGGCTCATTGGCGTCTGTTTTCAGGGCTCTGACAGAGAGGGTTTCCCAGAACCTGTGGTCATCTTGCCTTTCATGAAACACGGAGACCTACACAGTTTCCTCCTGTACTCCCGGCTCGGGGACCAGCCAGTGTTCCTGCCCACTCAGAT

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Catherine Wilson et al.
Cancer research, 74(20), 5878-5890 (2014-08-16)
Molecularly targeted drug therapies have revolutionized cancer treatment; however, resistance remains a major limitation to their overall efficacy. Epithelial-to-mesenchymal transition (EMT) has been linked to acquired resistance to tyrosine kinase inhibitors (TKI), independent of mutational resistance mechanisms. AXL is a
Toni M Brand et al.
Cancer research, 74(18), 5152-5164 (2014-08-20)
The EGFR antibody cetuximab is used to treat numerous cancers, but intrinsic and acquired resistance to this agent is a common clinical outcome. In this study, we show that overexpression of the oncogenic receptor tyrosine kinase AXL is sufficient to
Rui Li et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(9), 7277-7283 (2015-04-22)
Increasing evidence has suggested that dysregulation of microRNAs (miRNAs) could contribute to tumor progression. The miR-34 family is directly transactivated by tumor suppressor p53 which is frequently mutated in various cancers; however, the effect of miR-34a on the ovarian cancer
Nam-Yi Kim et al.
International journal of oncology, 47(1), 353-360 (2015-05-16)
Metformin, the most frequently prescribed anti-diabetic drug, has recently been paid attention as a chemotherapeutic agent. In this study, we demonstrated that metformin decreased the viability of parental as well as cisplatin/taxol-resistant ovarian cancer cells. Its anti-proliferative effect was further

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica