Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU025021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccrk

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCCTAGGAGCACCTCTTTCTGATTTGCCTCCATGGCCTCCCCACGGCTATATATACCACACCTGGTCCTGCTCCTTAGTGTGCTTGAGGGCTGGGCTCTGGGAGGCAGAACCGTGAGATGTTCATCCCAGCAGAGAAAGAGACTCACGTCCTACAGACAAAGCCTCCAGAAACTGCTAGCTGTGTCCTTCTCCAGGGCCACCCCTCAGTGGTGCCACCCGGCCTTAGAGATGATTGTCAGGCTCTGTCCCCTCTTCAAGGACATTGGTACTACAGCACCACCTGGTGGAAGCACAGAGTATAAGCTGTCTTCATACCGGGGACACAGCTGGGAAGTCAGACATGTTTTAGTTTTGGTTCCACTGGGTCAGGATTTGAGGTTCATATAAAAGCCCTGGGTGTTTCTGTCTAATTGCACCTTGTCTGTTGCTGTTAGGGAAAGGACAATGGTGG

Ensembl | Número de adesão de camundongo

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Se precisar de ajuda, entre em contato Atendimento ao cliente

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hai Feng et al.
Journal of hepatology, 62(5), 1100-1111 (2014-12-17)
Aberrant chromatin modification is a key feature of hepatocellular carcinoma (HCC), which is characterized by strong sexual dimorphism. Both enhancer of zeste homolog 2 (EZH2) and cell cycle-related kinase (CCRK) contribute to hepatocarcinogenesis, yet whether the two oncogenic factors have
Zhuo Yu et al.
Gut, 63(11), 1793-1804 (2014-01-21)
Androgen receptor (AR) signalling contributes to male predominance in hepatocellular carcinoma (HCC), which is more pronounced in HBV-endemic areas. Cell cycle-related kinase (CCRK) is essential for AR-induced hepatocarcinogenesis but its molecular function in HBV-associated HCC remains obscure. To determine the
Bin You et al.
Oncotarget, 6(6), 4357-4368 (2015-03-05)
Alterations of the EGFR/ERK and Hippo/YAP pathway have been found in non-small cell lung cancer (NSCLC). Herein, we show that ERK1 and ERK2 have an effect on the Hippo/YAP pathway in human NSCLC cells. Firstly, inhibition of ERK1/2 by siRNA

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica