Todas as fotos(1)

Key Documents

EMU025021

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting mouse Ccrk

Faça loginpara ver os preços organizacionais e de contrato

Todas as fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descrição

linha de produto

MISSION^®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

GCCCTAGGAGCACCTCTTTCTGATTTGCCTCCATGGCCTCCCCACGGCTATATATACCACACCTGGTCCTGCTCCTTAGTGTGCTTGAGGGCTGGGCTCTGGGAGGCAGAACCGTGAGATGTTCATCCCAGCAGAGAAAGAGACTCACGTCCTACAGACAAAGCCTCCAGAAACTGCTAGCTGTGTCCTTCTCCAGGGCCACCCCTCAGTGGTGCCACCCGGCCTTAGAGATGATTGTCAGGCTCTGTCCCCTCTTCAAGGACATTGGTACTACAGCACCACCTGGTGGAAGCACAGAGTATAAGCTGTCTTCATACCGGGGACACAGCTGGGAAGTCAGACATGTTTTAGTTTTGGTTCCACTGGGTCAGGATTTGAGGTTCATATAAAAGCCCTGGGTGTTTCTGTCTAATTGCACCTTGTCTGTTGCTGTTAGGGAAAGGACAATGGTGG

Ensembl | Número de adesão de camundongo

ENSMUSG00000021483

nº de adesão NCBI

NM_053180

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... CCRK(105278) , Ccrk(105278)

Categorias relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descrição geral

MISSION^® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

A CCRK-EZH2 epigenetic circuitry drives hepatocarcinogenesis and associates with tumor recurrence and poor survival of patients.

Hai Feng et al.

Journal of hepatology, 62(5), 1100-1111 (2014-12-17)

Aberrant chromatin modification is a key feature of hepatocellular carcinoma (HCC), which is characterized by strong sexual dimorphism. Both enhancer of zeste homolog 2 (EZH2) and cell cycle-related kinase (CCRK) contribute to hepatocarcinogenesis, yet whether the two oncogenic factors have

Zhuo Yu et al.

Gut, 63(11), 1793-1804 (2014-01-21)

Androgen receptor (AR) signalling contributes to male predominance in hepatocellular carcinoma (HCC), which is more pronounced in HBV-endemic areas. Cell cycle-related kinase (CCRK) is essential for AR-induced hepatocarcinogenesis but its molecular function in HBV-associated HCC remains obscure. To determine the

Inhibition of ERK1/2 down-regulates the Hippo/YAP signaling pathway in human NSCLC cells.

Bin You et al.

Oncotarget, 6(6), 4357-4368 (2015-03-05)

Alterations of the EGFR/ERK and Hippo/YAP pathway have been found in non-small cell lung cancer (NSCLC). Herein, we show that ERK1 and ERK2 have an effect on the Hippo/YAP pathway in human NSCLC cells. Firstly, inhibition of ERK1/2 by siRNA

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica