Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU022311

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gnl3

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CCAAAGCAGGCAAACAGAATCCAAAGAAGTTACATTGCCAGGAACTTAAAAAGGTGATTGAAGCCTCAGACATTGTGTTAGAAGTTTTGGATGCCAGAGATCCTCTTGGTTGCAGGTGTCCTCAGATAGAAGAAGCTGTTATCCAGAGTGGGAGTAAGAAGCTGATACTTGTATTAAATAAGTCTGATCTAGTACCAAAGGAGAATTTGGAGAACTGGCTAAATTATTTGAATAAAGAATTGCCAACCGTGGTGTTCAAAGCCTCAACAAACTTAAAGAACAGAAAGACATTCAAGATAAAAAAGAAGAAAGTTGTTCCATTCCAAAGCAAAATCTGCTGTGGCAAGGAAGCCCTTTGGAAGCTTCTTGGAGATTTTCAGCAGTCCTGTGGAAAGGATATTCAAGTTGGAGTGATTGGTTTCCCAAATGTGGGGAAAAGCAGTGTC

Ensembl | Número de adesão de camundongo

ENSMUSG00000042354

nº de adesão NCBI

NM_153547

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... GNL3(30877) , Gnl3(30877)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Mei-Hong Li et al.
Journal of pediatric surgery, 49(8), 1286-1291 (2014-08-06)
Neuroblastoma (NB) is the most common extracranial solid tumor of childhood. Preliminary data derived from a human angiogenesis array in NB showed that the bioactive lipid sphingosine-1-phosphate (S1P) induced the secretion of several angiogenesis-related proteins including the important inflammatory factor
Tengwei Cao et al.
PloS one, 9(8), e103793-e103793 (2014-08-08)
Atrial hypertrophy and fibrosis are essential pathological features of atrial fibrillation. Recently, adiponectin has become a protein of interest due to its beneficial effects on cardiovascular diseases. However, the molecular mechanism of atrial structural remodeling and signaling pathways evoked by
Zhihong Yuan et al.
PloS one, 9(5), e94241-e94241 (2014-05-21)
It is increasingly recognized that the tumor microenvironment plays a critical role in the initiation and progression of lung cancer. In particular interaction of cancer cells, macrophages, and inflammatory response in the tumor microenvironment has been shown to facilitate cancer
Junyue Xing et al.
Molecular and cellular biology, 35(23), 4043-4052 (2015-09-24)
The tRNA methytransferase NSun2 promotes cell proliferation, but the molecular mechanism has not been elucidated. Here, we report that NSun2 regulates cyclin-dependent kinase 1 (CDK1) expression in a cell cycle-dependent manner. Knockdown of NSun2 decreased the CDK1 protein level, while

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica