Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EMU021521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tiam1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAGATGGCAAGAGGGAGAAGGAAGTGGTCTTACCCAGTGTCCACCAGCACAACCCCGACTGTGACATTTGGGTCCATGAATATTTCACTCCATCCTGGTTCTGTCTACCCAACAACCAGCCAGCCTTGACGGTTGTCCGGCCAGGGGACACTGCGAGGGACACCTTGGAGCTCATTTGCAAGACACATCAACTGGATCATTCCGCCCATTACCTGCGCCTGAAATTCCTAATGGAGAACAGAGTGCAGTTCTACATCCCGCAGCCCGAGGAGGACATTTACGAGCTGCTTTACAAAGAAATTGAAATCTGTCCAAAAGTCACCCAGAATATCCACATTGAGAAGTCAGACGCGGCCGCTGATAATTACGGGTTTTTGCTTTCTTCTGTGGATGAAGATGGCATTCGAAGGCTCTACGTGAACAGTGTCAAGGAAACCGGGTTAG

Ensembl | Número de adesão de camundongo

ENSMUSG00000002489

nº de adesão NCBI

NM_001145887

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... TIAM1(21844) , Tiam1(21844)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Não está encontrando o produto certo?  

Experimente o nosso Ferramenta de seleção de produtos.

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Minjuan Wu et al.
Clinical science (London, England : 1979), 129(7), 575-588 (2015-05-23)
The homing ability and secretory function of mesenchymal stem cells (MSCs) are key factors that influence cell involvement in wound repair. These factors are controlled by multilayer regulatory circuitry, including adhesion molecules, core transcription factors (TFs) and certain other regulators.
Mina Ding et al.
OncoTargets and therapy, 11, 4367-4375 (2018-08-14)
T-cell lymphoma invasion and metastasis inducing factor 1 (Tiam1) is known to be involved in tumor progression. However, its molecular roles and mechanism in pancreatic ductal adenocarcinoma (PDAC) remain unclear. The purpose of this study is to determine Tiam1 expression
G Zhu et al.
Oncogene, 34(49), 5971-5982 (2015-03-10)
Epidermal growth factor receptor (EGFR) signaling regulates cell growth and survival, and its overactivation drives cancer development. One important branch of EGFR signaling is through activation of GTPase Rac1, which further promotes cell proliferation, survival and cancer metastasis. Here, we
Helen J Whalley et al.
Nature communications, 6, 7437-7437 (2015-06-17)
Centrosome separation is critical for bipolar spindle formation and the accurate segregation of chromosomes during mammalian cell mitosis. Kinesin-5 (Eg5) is a microtubule motor essential for centrosome separation, and Tiam1 and its substrate Rac antagonize Eg5-dependent centrosome separation in early

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica